Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
SHARK7 Resource Report Resource Website |
RRID:Addgene_248175 | N/A | None | PMID:41529903 | K-12 _(ara-leu) 7697 araD139 fhuA _lacX74 galK16 galE15 e14- _80dlacZ_M15 recA1 relA1 endA1 nupG rpsL (StrR) rph spoT1 _(mrr-hsdRMS-mcrBC) _lacI::(J23101-BujardRBS-LambdaCI-ECK120029600, PTet-RiboJ-B0064-Pir116-L3S3P21*) Please visit https://doi.org/10.1101/2025.10.06.680659 for bioRxiv preprint. | Vector Backbone:N/A; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None | 2026-07-25 01:05:50 | 0 | ||
|
TB201 Resource Report Resource Website |
RRID:Addgene_230031 | MG1655 attP21::PR-mYFP::frt | None | PMID:29355812 | Strain Validation: Fluorescence, PCR for fluorescent marker gene. Inserted into attP21 and PCR-verified following methods described in Haldimann and Wanner, JBact 2001, PMID 11591683, using pAH68FRT-Cat as cloning and insertion plasmid. | Vector Backbone:NA; Vector Types:; Bacterial Resistance:None | 2026-07-25 01:02:37 | 0 | ||
|
TB205 Resource Report Resource Website |
RRID:Addgene_230034 | MG1655 attP21::PR-mCherry::frt | None | PMID:28428424 | Strain Validation: Fluorescence, PCR for fluorescent marker gene. Inserted into attP21 and PCR-verified following methods described in Haldimann and Wanner, JBact 2001, PMID 11591683, using pAH68FRT-Cat as cloning and insertion plasmid. TB205 is fliC+ and wrongly annotated as ∆fliC in PMID 28428424. | Vector Backbone:NA; Vector Types:; Bacterial Resistance:None | 2026-07-25 01:02:37 | 0 | ||
|
TB204 Resource Report Resource Website |
RRID:Addgene_230033 | MG1655 attP21::PR-sfGFP::frt | None | PMID:29355812 | Strain Validation: Fluorescence, PCR for fluorescent marker gene. Inserted into attP21 and PCR-verified following methods described in Haldimann and Wanner, JBact 2001, PMID 11591683, using pAH68FRT-Cat as cloning and insertion plasmid. | Vector Backbone:NA; Vector Types:; Bacterial Resistance:None | 2026-07-25 01:02:37 | 0 | ||
|
TB202 Resource Report Resource Website |
RRID:Addgene_230032 | MG1655 attP21::PR-mCerulean::frt | None | Strain Validation: Fluorescence, PCR for fluorescent marker gene. Inserted into attP21 and PCR-verified following methods described in Haldimann and Wanner, JBact 2001, PMID 11591683, using pAH68FRT-Cat as cloning and insertion plasmid. | Vector Backbone:NA; Vector Types:; Bacterial Resistance:None | 2026-07-25 01:02:37 | 0 | |||
|
TB205 △trpC Resource Report Resource Website |
RRID:Addgene_230038 | MG1655 attP21::PR-mCherry::frt trpC::frt | None | PMID:32042125 | Strain Validation: Fluorescence, growth in M9+glucose +/- tryptophane, PCRs with primers flanking fluorescent marker gene or deleted gene. Primers: trpC_fwd: AACGTCGCCATGTTAATGCG trpC_rev: GAACTGAGCCTGAAATTCAGG | Vector Backbone:NA; Vector Types:; Bacterial Resistance:None | 2026-07-25 01:02:37 | 0 | ||
|
TB204 △trpC Resource Report Resource Website |
RRID:Addgene_230037 | MG1655 attP21::PR-sfGFP::frt trpC::frt | None | PMID:32042125 | Strain Validation: Fluorescence, growth in M9+glucose +/- tryptophane, PCRs with primers flanking fluorescent marker gene or deleted gene. Primers: trpC_fwd: AACGTCGCCATGTTAATGCG trpC_rev: GAACTGAGCCTGAAATTCAGG | Vector Backbone:NA; Vector Types:; Bacterial Resistance:None | 2026-07-25 01:02:37 | 0 | ||
|
B-95.ΔA Resource Report Resource Website |
RRID:Addgene_197933 | RNA polymerase gene (T7 phage)/chromosome | None | PMID:25982672 | Genotype: The same as BL21(DE3) except for the additional mutations at 95 UAG codons and disruption of the prfA gene | Vector Backbone:BL21(DE3); Vector Types:; Bacterial Resistance:None | 2026-07-25 12:59:26 | 0 | ||
|
E. coli BW25113 ΔphoP:PcpcG2-phoP*** (CMB259) Resource Report Resource Website |
RRID:Addgene_254897 | Carries a single chromosomal copy of constitutively active PhoP downstream of PcpcG2 promoter inserted in nupG locus | None | PMID:41996246 | For validation, use primers: FWD: CGTGAGCGGTAAAGTTGTTG and REV: CGGAGCTGCAAGGTGTTTATAG flanking the nupG locus to verify gene insertion. Please visit https://doi.org/10.1101/2024.11.27.625634 for bioRxiv preprint. | Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None | 2026-07-25 01:06:31 | 0 | ||
|
E. coli BW25113:PcpcG2-tetR (CMB247) Resource Report Resource Website |
RRID:Addgene_254898 | Carries a single chromosomal copy of the repressor TetR downstream of PcpcG2 promoter inserted in nupG locus | None | PMID:41996246 | For validation, use primers: FWD: CGTGAGCGGTAAAGTTGTTG and REV: CGGAGCTGCAAGGTGTTTATAG flanking the nupG locus to verify gene insertion. Please visit https://doi.org/10.1101/2024.11.27.625634 for bioRxiv preprint. | Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None | 2026-07-25 01:06:31 | 0 | ||
|
S4197 Resource Report Resource Website |
RRID:Addgene_200839 | Genotype: MG1655 rph+, ilvG+, ΔlacZ | Escherichia coli str. K-12 substr. MG1655 | None | PMID:20952573 | Corresponding wild-type strain (rapZ+, glmZ+, glmY+) for strain Z956 (Addgene Bacterial strain #200838). | Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None | 2026-07-25 12:58:23 | 0 | |
|
Top10∆serB Resource Report Resource Website |
RRID:Addgene_34928 | None | PMID:21868676 | To prevent possible enzymatic dephosphorylation of O-phospho-L-serine (Sep) in vivo, the gene encoding phosphoserine phosphatase (serB), which catalyzes the last step in serine biosynthesis, was deleted from Escherichia coli strain Top10. Markerless gene deletions were carried out using a λ-red and FLP recombinase-based gene knockout strategy. | Vector Backbone:None; Vector Types:; Bacterial Resistance:None | 2026-07-25 12:46:05 | 0 | |||
|
KTD101(DE3) Resource Report Resource Website |
RRID:Addgene_138651 | None | E. coli | None | PMID:31772280 | Genotype: λDE3 Δtig100 Δ(araD–araB)567 ΔlacZ4787(::rrnB-3) lacIP-4000(lacIQ) rph-1 Δ(rhaD–rhaB)568 hsdR514 KTD101(DE3) is a λDE3 derivative of the trigger factor deficient (Δtig) strain KTD101 from Puertas et al 2010 Protein Expression and Purification 74: 122–128, PMID 20600941. Puertas et al 2010 showed that deletion of trigger factor in the parent strain KTD101 increased the level of secreted recombinantly expressed protein. This strain may also improve the level of protein expression in the periplasm and in the outer membrane. This derivative strain KTD101(DE3) now allows expression that is based on the widely-used T7 promoter. The parent strain KTD101 was provided by François Baneyx at the University of Washington. DE3 lysogenization is apparent from positive expression that was obtained for the BBA57 protein upon expression from the T7 promoter plasmid pBBA57-TEV-His12, as was shown in Figure S5C, lane 7, of Robertson et al, Sci Rep. 2019 Nov 26;9(1):17606. doi: 10.1038/s41598-019-53830-x. | Vector Backbone:N/A; Vector Types:; Bacterial Resistance:None | 2026-07-25 12:54:35 | 0 | |
|
BA14 Resource Report Resource Website |
RRID:Addgene_186997 | bglR, thi-1, rel-1 HfrPO1, ∆nuoA-N | E. coli | None | PMID:16979134 | Parent strain is 1100, from Humbert et al. 1983 J Bacteriol. doi.org/10.1128/jb.153.1.416-422.1983 | Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None | 2026-07-25 12:55:20 | 0 | |
|
JEC027 Resource Report Resource Website |
RRID:Addgene_180310 | None | PMID:35077145 | Genotype: E. coli MG1655ΔCRISPR-Cas Method: Knockout using pKD46/pKD4 Created by: Baiyang Liu Knockout region from MG1655 genome: 995605 to 1006007 Primer Fw: GATTATCGACTGGGATAACC Primer Rv: CAGAAATATTCGACAAAGCG Expected PCR size for JEC027: 1kb Expected PCR size for MG1655: 10.4kb | Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None | 2026-07-25 12:54:24 | 0 | |||
|
LC-E02 Resource Report Resource Website |
RRID:Addgene_78551 | pTet--dCas9 cassette integrated at 186 primary attB site. | None | PMID:27060147 | Vector Backbone:na; Vector Types:; Bacterial Resistance:None | This is a bacterial strain | 2026-07-25 12:52:07 | 0 | ||
|
pSELECT-HA-mFOXO1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_83308 | FoxO1 | Mus musculus | None | PMID:27511131 | To construct pSELECT-HA-mFOXO1 the coding sequence of HA tag and FOXO1 were amplified from pCMV-HA-FOXO1 by PCR. The PCR product was digested with NheI and SalI restriction enzymes and inserted into the NheI and SalI sites of pSELECT-puro. The insert was sequenced and compared to mouse FOXO1 (NM_019739.3). Sequence identity was confirmed except for a conservative A->G mutation at base 474, a non-conservative A->G mutation at base 1121 and a non-conservative mutation T->C mutation at base 2321 of NM_019739.3. These mutations were confirmed to exist in the original pCMV-HA-FOXO1 plasmid. The non-conservative mutations result in a K->R substitution at amino acid 219 and a L->P substitution at amino acid 619 of mFOXO1 (NP_062713.2). Mutations at bases 1121 and 2321 were reversed to wild type by site-directed mutagenesis and the corrections were confirmed by sequencing | Backbone Marker:Invivogen; Backbone Size:3390; Vector Backbone:pSELECT-puro; Vector Types:Mammalian Expression; Bacterial Resistance:None | 2026-07-25 12:52:45 | 1 | |
|
EcAR7 Resource Report Resource Website 1+ mentions |
RRID:Addgene_52055 | None | None | PMID:22982858 | We recommend growth of the EcAR7 strain at 30 °C in LB supplemented with 0.08% glucose. The EcAR7 strains normally take 1.5-‐2 days to grow at 30°C, after transformation or streaking the strain on an agar plate (with the appropriate antibiotics). See supplemental information from referenced article for protocol on creating EcAR7 from EcNR2. | Vector Backbone:None; Vector Types:; Bacterial Resistance:None | 2026-07-25 12:48:18 | 5 | ||
|
HL 716 Resource Report Resource Website |
RRID:Addgene_60368 | See comments | None | PMID:21189298 | MG1655 + lacIq integrated at intS | Vector Backbone:N/A; Vector Types:Synthetic Biology; Bacterial Resistance:None | 2026-07-25 12:49:25 | 0 | ||
|
HL 770 Resource Report Resource Website |
RRID:Addgene_60369 | See comments | None | PMID:21189298 | MG1655 + lacIq intergrated at intS + Δ hfq | Vector Backbone:N/A; Vector Types:Synthetic Biology; Bacterial Resistance:None | 2026-07-25 12:49:25 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the kravitz2 Resources search. From here you can search through a compilation of resources used by kravitz2 and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that kravitz2 has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on kravitz2 then you can log in from here to get additional features in kravitz2 such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into kravitz2 you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Data set from Kravitz, Owen and Kretizer's 2012 paper "Optogenetic identification of striatal projection neuron subtypes during in vivo recordings."
