Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Bacterial Resistance:gentamicin (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

783 Results - per page

Show More Columns | Download 783 Result(s)

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pMMBrelAGent
 
Resource Report
Resource Website 		RRID:Addgene_45474 relA Gentamicin PMID:10447882 This is a vector control for IPTG-indicible E. coli relA gene. Backbone Marker:Bagdasarian Lab; Vector Backbone:pMMB67EH; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin truncated at EcoRI/PstI sites of RelA, but metabolically active 2026-07-25 12:47:26 0
pLX-TRV1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_180515 Tobacco rattle virus RNA1 Gentamicin PMID:35332696 Vector Backbone:pLX-Z4; Vector Types:Plant Expression; Bacterial Resistance:Gentamicin 2026-07-25 12:43:50 1
pACEBac1-ZZ-TEV-MZT2-3C-mEGFP
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_178074 MZT2A Homo sapiens Gentamicin PMID:33496729 Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin 2026-07-25 12:43:36 3
pACEBac1-GCP5
 
Resource Report
Resource Website 		RRID:Addgene_178071 GCP5 Homo sapiens Gentamicin PMID:33496729 Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin 2026-07-25 12:43:36 0
pACEBac1-GCP6
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_178072 GCP6 Homo sapiens Gentamicin PMID:33496729 Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin 2026-07-25 12:43:36 1
pACEBac1-gamma-tubulin(N229A)-TEV-His6
 
Resource Report
Resource Website 		RRID:Addgene_178077 gamma-tubulin with an N229A point mutation Homo sapiens Gentamicin PMID:33496729 Primers used to generate pACEBac1-gamma-tubulin(N229A)-TEV-His6 via site-directed mutagenesis were CCCATCCTTCTCCCAGATCGCCCAGCTGGTGTCTACCATCATGTC and GACATGATGGTAGACACCAGCTGGGCGATCTGGGAGAAGGATGGG Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin Changed Asparagine 229 to Alanine 2026-07-25 12:43:36 0
pACEBac1-MZT1
 
Resource Report
Resource Website 		RRID:Addgene_178075 MZT1 Homo sapiens Gentamicin PMID:33496729 Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin 2026-07-25 12:43:36 0
pACEBac1-beta-actin
 
Resource Report
Resource Website 		RRID:Addgene_178076 beta-actin Homo sapiens Gentamicin PMID:33496729 Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin 2026-07-25 12:43:36 0
pACEBac1-gamma-tubulin-TEV-His6
 
Resource Report
Resource Website 		RRID:Addgene_178067 gamma-tubulin Homo sapiens Gentamicin PMID:33496729 Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin 2026-07-25 12:43:36 0
BASIC_SEVA_67.10
 
Resource Report
Resource Website 		RRID:Addgene_178940 mScarlet counter-selection cassette Synthetic Gentamicin PMID:36381610 Cloning method: BASIC DNA assembly . Please visit https://www.biorxiv.org/content/10.1101/2022.01.06.446575v2 for bioRxiv preprint. Backbone Size:2607; Vector Backbone:BASIC_SEVA_67.10; Vector Types:Synthetic Biology; Bacterial Resistance:Gentamicin 2026-07-25 12:43:43 0
pDON207 NSP3 K977Q
 
Resource Report
Resource Website 		RRID:Addgene_180057 SARS-CoV-2 NSP3 K977Q SARS-CoV-2 Gentamicin PMID:34709727 Vector Backbone:pDON207; Vector Types:Mammalian Expression; Bacterial Resistance:Gentamicin NSP3 K977Q 2026-07-25 12:43:48 0
pDONRG_P4-P1R:TBA2p
 
Resource Report
Resource Website 		RRID:Addgene_128429 TESTA ABUNDANT 2 Arabidopsis thaliana Gentamicin PMID:31422517 For use with Three-way Multi-site Gateway Cloning (Invitrogen). Backbone Marker:Invitrogen modified by doi:10.1271/bbb.70678; Backbone Size:5892; Vector Backbone:pDONRG_P4-P1R; Vector Types:Gateway promoter entry clone; Bacterial Resistance:Gentamicin 2026-07-25 12:37:50 0
pORTMAGE502B
 
Resource Report
Resource Website 		RRID:Addgene_128971 PapRecT P. aeruginosa Gentamicin Backbone Size:4000; Vector Backbone:pSEVA258; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin 2026-07-25 12:37:56 0
pACEBac1-Q22YU3 del C3-2xStrep
 
Resource Report
Resource Website 		RRID:Addgene_170316 Q22YU3 C-terminal truncation (Delta-C3) Tetrahymena thermophila Gentamicin PMID:33632841 Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin Deletion of C-terminal C3-finger 2026-07-25 12:42:36 0
pDONR207-MUM2sp-ADPG2
 
Resource Report
Resource Website 		RRID:Addgene_170723 ARABIDOPSIS DEHISCENCE ZONE POLYGALACTURONASE 2 Arabidopsis thaliana Gentamicin PMID:34059917 For use with Three-way Multi-site Gateway Cloning (Invitrogen). Backbone Marker:Invitrogen; Backbone Size:5585; Vector Backbone:pDONR207; Vector Types:Gateway Donor vector / entry clone; Bacterial Resistance:Gentamicin 2026-07-25 12:42:39 0
pDONR207-MUM2sp-RglB
 
Resource Report
Resource Website 		RRID:Addgene_170721 Rhamnogalacturonan lyase B Aspergillus nidulans Gentamicin PMID:34059917 For use with Three-way Multi-site Gateway Cloning (Invitrogen). Backbone Marker:Invitrogen; Backbone Size:5585; Vector Backbone:pDONR207; Vector Types:Gateway Donor vector / entry clone; Bacterial Resistance:Gentamicin 2026-07-25 12:42:39 0
pDONR207-MUM2sp-PelA
 
Resource Report
Resource Website 		RRID:Addgene_170722 Pectin lyase A Aspergillus nidulans Gentamicin PMID:34059917 For use with Three-way Multi-site Gateway Cloning (Invitrogen). Backbone Marker:Invitrogen; Backbone Size:5585; Vector Backbone:pDONR207; Vector Types:Gateway Donor vector / entry clone; Bacterial Resistance:Gentamicin 2026-07-25 12:42:39 0
pDONR207-MUM2sp-Citrine-ADPG2
 
Resource Report
Resource Website 		RRID:Addgene_170725 ARABIDOPSIS DEHISCENCE ZONE POLYGALACTURONASE 2 Arabidopsis thaliana Gentamicin PMID:34059917 For use with Three-way Multi-site Gateway Cloning (Invitrogen). Backbone Marker:Invitrogen; Backbone Size:5585; Vector Backbone:pDONR207; Vector Types:Gateway Donor vector / entry clone; Bacterial Resistance:Gentamicin 2026-07-25 12:42:39 0
pPPC030.306
 
Resource Report
Resource Website 		RRID:Addgene_171151 J306 scRNA Synthetic Gentamicin PMID:33930546 Alternative names: pCK162, pBBR1-GmR_J3-BBa_J23117-mvaES Backbone Marker:Jesse Zalatan; Backbone Size:6261; Vector Backbone:pPPC020.306; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Gentamicin 2026-07-25 12:42:42 0
pPPC027.306
 
Resource Report
Resource Website 		RRID:Addgene_171149 J306 scRNA Synthetic Gentamicin PMID:33930546 Alternative names: pCK134, pBBR1-GmR_J3-BBa_J23117-GTPCH_J3-BBa_J23117-PTPS_J3-BBa_J23117-SR Backbone Marker:Jesse Zalatan; Backbone Size:6261; Vector Backbone:pPPC020.306; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Gentamicin 2026-07-25 12:42:42 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. Kravitz Dataset 2 Resources

    Welcome to the kravitz2 Resources search. From here you can search through a compilation of resources used by kravitz2 and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that kravitz2 has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on kravitz2 then you can log in from here to get additional features in kravitz2 such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into kravitz2 you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Data set from Kravitz, Owen and Kretizer's 2012 paper "Optogenetic identification of striatal projection neuron subtypes during in vivo recordings."

Recent News Entries

Kravitz Dataset 2

Contact Us

E [email protected]

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch