Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Bacterial Resistance:gentamicin (facet)


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

783 Results - per page

Show More Columns | Download 783 Result(s)

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
pAM3558
 
Resource Report
Resource Website
RRID:Addgene_40252 Gm cassette (BssHII+SphI) Synechococcus elongatus PCC 7942 Gentamicin PMID:18353436 NS1 vector Gm resistant version of pAM1303. Both pAM1303 and pAM3511 were digested with BssHII and SphI, and then mix-ligated. The accC1gene (Gm) replaces the aadA gene (SpSm) in the Ω cassette. The upstream T4 terminator was lost due to SphI digestion. Vector Backbone:pAM1303; Vector Types:Cyanobacteria cloning vector; Bacterial Resistance:Gentamicin 2026-07-25 12:46:42 0
pEN_hU6miR-Gb2-K
 
Resource Report
Resource Website
RRID:Addgene_25759 Gb2 miR-shRNA Mus musculus Gentamicin PMID:16945906 Entry vector with U6-driven G beta 2 miR-shRNA G beta 2 miR-shRNA: TGCTCATGTATTCCCACGACAA Backbone Marker:ATCC 10326362; Backbone Size:4310; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin 2026-07-25 12:45:01 0
pEN_TTmcs
 
Resource Report
Resource Website
10+ mentions
RRID:Addgene_25755 Gentamicin PMID:16945906 shRNA expression; miR30-based topology; TRE-TIGHT Pmin promoter + DsRed2 spacer; Entry vector backbone; +ccdB in parent; Spe1 d/s of TRE-TIGHT Backbone Marker:ATCC 10326362; Backbone Size:4218; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin 2026-07-25 12:45:01 19
pEN_hU6miR-G12-E
 
Resource Report
Resource Website
RRID:Addgene_25757 G alpha 12 miR-shRNA Mus musculus Gentamicin PMID:16945906 Entry vector with U6-driven G alpha 12 miR-shRNA G alpha 12 miR-shRNA: GCGACACCATCTTCGACAACAT Addgene sequence shows that this plasmid is missing the EcoRI site. Backbone Marker:ATCC 10326362; Backbone Size:4310; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin 2026-07-25 12:45:01 0
pEN_TTmiRc2
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_25752 Gentamicin PMID:16945906 shRNA expression; miR30-based topology; TRE-TIGHT Pmin promoter; Entry vector backbone; +ccdB in parent; Spe1 d/s of TRE-TIGHT Backbone Marker:ATCC 10326362; Backbone Size:4422; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin 2026-07-25 12:45:01 6
pEN_Tmcs
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_25751 Gentamicin PMID:16945906 TRE Pmin promoter; Entry vector backbone; +ccdB in parent; Multiple cloning sites d/s of TRE Backbone Marker:ATCC 10326362; Backbone Size:4347; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin 2026-07-25 12:45:01 6
pEN_TRE_GFP
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_25767 Gentamicin PMID:16945906 Entry vector with TRE-driven GFP Backbone Marker:ATCC 10326362; Backbone Size:4655; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin 2026-07-25 12:45:02 1
pEN_TmiR_G13-L_G12-E
 
Resource Report
Resource Website
RRID:Addgene_25763 G alpha 13 and 12 miR-shRNA Mus musculus Gentamicin PMID:16945906 Entry vector with TRE-driven G alpha 12 and 13 miR-shRNA G alpha 12 miR-shRNA: GCGACACCATCTTCGACAACAT G alpha 13 miR-shRNA: CTGGGTGAGTCTGTAAAGTATT There are 3 minor changes between depositor's sequence and Addgene's sequence - An extra T between the TRE promoter and first shRNA; a 17nt stretch between the shRNAs is different but will not affect function; and a single nt change mutates an EcoRI site just beyond the 2nd shRNA but will again not affect function. Backbone Marker:ATCC 10326362; Backbone Size:4641; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin 2026-07-25 12:45:01 0
pEN_TmiR_G13-L
 
Resource Report
Resource Website
RRID:Addgene_25762 G alpha 13 miR-shRNA Mus musculus Gentamicin PMID:16945906 Entry vector with TRE-driven G alpha 13 miR-shRNA G alpha 13 miR-shRNA: CTGGGTGAGTCTGTAAAGTATT Addgene sequence shows that this plasmid is missing the SpeI site. Backbone Marker:ATCC 10326362; Backbone Size:4259; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin 2026-07-25 12:45:01 0
pEN_TGmiR_Luc-A
 
Resource Report
Resource Website
RRID:Addgene_25765 Luciferase miR-shRNA Gentamicin PMID:16945906 Entry vector with TRE-driven luciferase miR-shRNA and co-expressed GFP Luciferase shRNA sequence is - 5'- CCCGCCTGAAGTCTCTGATTAATAGTGAAGCC ACAGATGTATTAATCAGAGACTTCAGGCGGT Backbone Marker:ATCC 10326362; Backbone Size:4990; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin 2026-07-25 12:45:02 0
pEN_TmiR_Gb2-K
 
Resource Report
Resource Website
RRID:Addgene_25764 Gb2 miR-shRNA Mus musculus Gentamicin PMID:16945906 Entry vector with TRE-driven G beta 2 miR-shRNA: TGCTCATGTATTCCCACGACAA Addgene sequence shows that this plasmid is missing the SpeI site. Backbone Marker:ATCC 10326362; Backbone Size:4259; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin 2026-07-25 12:45:01 0
pEN_TmiR_Luc-A
 
Resource Report
Resource Website
RRID:Addgene_25760 Luciferase miR-shRNA Gentamicin PMID:16945906 Entry vector with TRE-driven luciferase miR-shRNA Luciferase shRNA sequence is - 5'- CCCGCCTGAAGTCTCTGATTAATAGTGAAGCC ACAGATGTATTAATCAGAGACTTCAGGCGGT Backbone Marker:ATCC 10326362; Backbone Size:4259; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin 2026-07-25 12:45:01 0
pEN_TGmiRc3
 
Resource Report
Resource Website
RRID:Addgene_25749 Gentamicin PMID:16945906 shRNA expression; miR30-based topology; TRE Pmin promoter + GFP spacer; Entry vector backbone; +ccdB in parent; Multiple unique sites d/s of TRE Backbone Marker:ATCC 10326362; Backbone Size:5303; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin 2026-07-25 12:45:01 0
pEN_TmiRc3
 
Resource Report
Resource Website
10+ mentions
RRID:Addgene_25748 Gentamicin PMID:16945906 shRNA expression; miR30-based topology; TRE Pmin promoter; Entry vector backbone; +ccdB in parent; Multiple unique sites d/s of TRE Backbone Marker:ATCC 10326362; Backbone Size:4608; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin 2026-07-25 12:45:01 12
pPROBE-GT
 
Resource Report
Resource Website
RRID:Addgene_37814 Promotorless gfp reporter gene bacteria Gentamicin PMID:11059491 Please refer to the attached table for a complete list of restriction sites in the MCS. This plasmid has the XbaI site. Vector Backbone:pVS1/p15a; Vector Types:; Bacterial Resistance:Gentamicin 2026-07-25 12:46:24 0
pUAS-Luc
 
Resource Report
Resource Website
RRID:Addgene_21604 UAS-hsp70 luciferase Gentamicin PMID:19481053 Backbone Marker:Stratagene; Backbone Size:3415; Vector Backbone:pBluescript SK(-); Vector Types:Insect Expression; Bacterial Resistance:Gentamicin 2026-07-25 12:44:26 0
LI dy C-D
 
Resource Report
Resource Website
RRID:Addgene_54343 C-D dummy Synthetic Gentamicin PMID:24551083 L1 dummy. Backbone Marker:Parniske lab; Vector Backbone:pUC57 (Gent); Vector Types:cloning vector; Bacterial Resistance:Gentamicin 2026-07-25 12:48:39 0
pEN_TT MEK5-DD-mRFP1
 
Resource Report
Resource Website
RRID:Addgene_47547 MEK5-DD Homo sapiens Gentamicin PMID:23332156 Backbone Marker:Addgene #25752; Backbone Size:4422; Vector Backbone:pEN_TTmiRc2; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin S311D, T315D 2026-07-25 12:47:42 0
pDONR207-Citrine-NLS
 
Resource Report
Resource Website
RRID:Addgene_44586 Citrine-NLS Synthetic Gentamicin PMID:23421791 Backbone Marker:Invitrogen; Backbone Size:3374; Vector Backbone:pDONR207; Vector Types:; Bacterial Resistance:Gentamicin 2026-07-25 12:47:20 0
pMMBGent
 
Resource Report
Resource Website
RRID:Addgene_45475 Gentamycin Gentamicin PMID:10447882 This is a vector control for IPTG-indicible E. coli relA gene. Backbone Marker:Bagdasarian Lab; Vector Backbone:pMMB67EH; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin 2026-07-25 12:47:27 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. Kravitz Dataset 2 Resources

    Welcome to the kravitz2 Resources search. From here you can search through a compilation of resources used by kravitz2 and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that kravitz2 has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on kravitz2 then you can log in from here to get additional features in kravitz2 such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into kravitz2 you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.