Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
HL 5226 Resource Report Resource Website |
RRID:Addgene_63667 | see comments | None | PMID:26261213 | MG1655 + lacIq intergrated at intS + ΔglmZ | Vector Backbone:N/A; Vector Types:Synthetic Biology; Bacterial Resistance:None | 2026-07-25 12:49:53 | 0 | ||
|
SJ358 Resource Report Resource Website |
RRID:Addgene_67755 | none | None | PMID:26251500 | The genotype of the strain relative to MG1655 is complex, since there are many single nucleotide variations and several 10-20kb differences (Brown & Jun (2015) Genome Announcements, Lyons et. al. (2011) PLoS ONE). There are a particular abundance of differences in the rDNA operons, which in several cases align more closely to E. coli strains DH10B, MDS42, and W. Particularly relevant genotypes are: λ+ gal+ eut+ pyrE+ ilvG+ rpoS33Am glnV(SupAm) evgA::IS1 Δrfb | Vector Backbone:none; Vector Types:; Bacterial Resistance:None | 2026-07-25 12:50:29 | 0 | ||
|
MG1655 Z1 malE Resource Report Resource Website 1+ mentions |
RRID:Addgene_65915 | MG1655 Z1 malE | None | PMID:26900850 | F-, lambda-, rph-1, laciq, PN25-tetR, SpR, malE- | Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None | 2026-07-25 12:50:13 | 1 | ||
|
CY027 Resource Report Resource Website |
RRID:Addgene_72402 | None | PMID:26315440 | No antibiotic resistance. | Vector Backbone:E. coli BW25113; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:None | 2026-07-25 12:51:07 | 0 | |||
|
HL 6703 Resource Report Resource Website |
RRID:Addgene_69778 | None | PMID:27084942 | Vector Backbone:none; Vector Types:Synthetic Biology; Bacterial Resistance:None | 2026-07-25 12:50:44 | 0 | ||||
|
HL 6686 Resource Report Resource Website |
RRID:Addgene_69775 | None | PMID:27084942 | Vector Backbone:none; Vector Types:Synthetic Biology; Bacterial Resistance:None | 2026-07-25 12:50:44 | 0 | ||||
|
HL 3500 Resource Report Resource Website |
RRID:Addgene_69774 | None | PMID:27084942 | Vector Backbone:none; Vector Types:Synthetic Biology; Bacterial Resistance:None | 2026-07-25 12:50:44 | 0 | ||||
|
HL 6778 Resource Report Resource Website |
RRID:Addgene_69782 | None | PMID:27084942 | Vector Backbone:none; Vector Types:Synthetic Biology; Bacterial Resistance:None | 2026-07-25 12:50:44 | 0 | ||||
|
HL 6777 Resource Report Resource Website |
RRID:Addgene_69781 | None | PMID:27084942 | Vector Backbone:none; Vector Types:Synthetic Biology; Bacterial Resistance:None | 2026-07-25 12:50:44 | 0 | ||||
|
BLIM cells Resource Report Resource Website 1+ mentions |
RRID:Addgene_35609 | none | None | PMID:10610690 | To be used with the following plasmids from the Matthews lab: pTARA (www.addgene.org/31491), pLS1 (www.addgene.org/31490), and (www.addgene.org/31492) pLS1/-11 | Vector Backbone:NA; Vector Types:; Bacterial Resistance:None | 2026-07-25 12:46:10 | 1 | ||
|
LC-E03 Resource Report Resource Website |
RRID:Addgene_78552 | pTet--Cas9 cassette integrated at 186 primary attB site | None | PMID:27060147 | Vector Backbone:na; Vector Types:; Bacterial Resistance:None | This is a bacterial strain | 2026-07-25 12:52:07 | 0 | ||
|
pSELECT-HA-mFOXO1-D256 Resource Report Resource Website 1+ mentions |
RRID:Addgene_83379 | Forkhead box O1 | Mus musculus | None | Backbone Marker:Invivogen; Backbone Size:3390; Vector Backbone:pSELECT-puro; Vector Types:Mammalian Expression; Bacterial Resistance:None | N256TAG (premature stop codon) | 2026-07-25 12:52:46 | 1 | ||
|
E. coli ER1821ΔlacI Resource Report Resource Website |
RRID:Addgene_141407 | None | PMID:31980824 | λ- F- glnX44 e14- (McrA-) rfbD1 endA1 thi-1 Δ(yjiT-opgB)114::IS10 (EcoKI R- M- McrBC- Mrr-) + rpoS393(am) creC510 lrhA::IS3 ydeN::IS10 ΔlacI Verification of lacI deletion: PCR reaction on genomic DNA using AK362 and AK365 primers produces a 1936 bp fragment AK 362 5’-CAATACCAATCGCACGCGG AK 365 5’-CGAGACGTCACGGAAAATGCC Phenotype: Constitutive β-galactosidase synthesis This strain was derived from the precursor strain, E. coli ER1821, which is described in Jobling et al. (2016) Complete Genome Sequence of Escherichia coli ER1821R, a Laboratory K-12 Derivative Engineered To Be Deficient in All Methylcytosine and Methyladenine Restriction Systems. Genome Announc 4(4):e00763-16. https://www.ncbi.nlm.nih.gov/pubmed/27516504 | Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None | 2026-07-25 12:39:41 | 0 | |||
|
LC-E18 Resource Report Resource Website |
RRID:Addgene_115924 | none | None | PMID:29765036 | E. coli K12 MG1655 genotype: F- λ- ilvG- rfb-50 rph-1 Integration at lambda attB: pOSIP-KL-sulA-GFP Integration at HK022 attB: pOSIP-KO-RBS2-dCas9 SulA-GFP acts as an SOS response reporter. | Vector Backbone:none; Vector Types:; Bacterial Resistance:None | 2026-07-25 12:35:53 | 0 | ||
|
AV04 Resource Report Resource Website |
RRID:Addgene_115926 | none | None | PMID:29765036 | E. coli K12 MG1655 genotype: F- λ- ilvG- rfb-50 rph-1 Integration at lambda attB: pOSIP-KL-mCherry Integration at primary 186 attB: pOSIP-KO-RBS2-dCas9 mCherry quantifies dCas9 repression | Vector Backbone:none; Vector Types:; Bacterial Resistance:None | 2026-07-25 12:35:53 | 0 | ||
|
IF189 Resource Report Resource Website |
RRID:Addgene_134836 | lysogen of a temperature-inducible bacteriophage lambda | None | PMID:28522818 | Genotype is [λ+ Lac- galK2 IN(rrnD-rrnE)1 rph-1], a derivative of strain W3102 Phenotypic assay: Grow at 30°C, but restricted at 42°C due to the induction of phage particles and cell lysis. | Vector Backbone:none; Vector Types:; Bacterial Resistance:None | 2026-07-25 12:38:46 | 0 | ||
|
E. coli BL21 (DE3) ΔEntD Resource Report Resource Website |
RRID:Addgene_192874 | The strain has a 535 nt deletion between nt 15 and nt 551 in the EntD gene. | E.coli | None | PMID:16709676 | EntD, a 4'-phosphopantetheinyl transferase, is required for native enterobactin synthesis. This strain allows for expression of nonribosomal peptide synthetase (NRPS) carrier proteins that do not harbor a phosphopantetheinyl group. | Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None | 2026-07-25 12:58:47 | 0 | |
|
Δrpi Resource Report Resource Website |
RRID:Addgene_234837 | ΔrpiAB Δedd strain | None | Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None | 2026-07-25 01:04:11 | 0 | ||||
|
B95 ΔAΔfabRΔselABC Resource Report Resource Website |
RRID:Addgene_234550 | None | None | PMID:34411545 | Genotype: The same as BL21(DE3) except for the additional mutations at 95 UAG codons, disruption of prfA, and frameshift in fabR and deletion of selABC. | Vector Backbone:N/A; Vector Types:; Bacterial Resistance:None | 2026-07-25 01:03:34 | 0 | ||
|
TB205 △proC △hisL Resource Report Resource Website |
RRID:Addgene_229552 | MG1655 attP21::PR-mCherry::frt proC::frt hisL::frt | n/a | None | PMID:40509754 | Primers for sequence verification of hisL knock-out: Fwd - prEP229, gtgaggataagaggtggcga Rev - prEP230, tcctttccccgctcattcat Please visit https://doi.org/10.1101/2024.07.19.604250 for bioRxiv preprint. | Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None | 2026-07-25 01:03:48 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the kravitz2 Resources search. From here you can search through a compilation of resources used by kravitz2 and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that kravitz2 has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on kravitz2 then you can log in from here to get additional features in kravitz2 such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into kravitz2 you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Data set from Kravitz, Owen and Kretizer's 2012 paper "Optogenetic identification of striatal projection neuron subtypes during in vivo recordings."
