Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Bacterial Resistance:chloramphenicol (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

164,519 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pMC8b-XI1up
 
Resource Report
Resource Website 		RRID:Addgene_176166 5' homology for integration site XI-1 Saccharomyces cerevisiae Chloramphenicol PMID:34860007 Constructed using the Yeast Modular Cloning Toolkit (Lee et al. ACS Synth Biol. 2015). Homologous region amplified from EasyClone-MarkerFree toolkit (Jessop-Fabre et al. Biotechnol J. 2016). Vector Backbone:pYTK001; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol 2026-07-25 12:43:19 0
pMC7-XI1dw
 
Resource Report
Resource Website 		RRID:Addgene_176167 3' homology for integration site XI-1 Saccharomyces cerevisiae Chloramphenicol PMID:34860007 Constructed using the Yeast Modular Cloning Toolkit (Lee et al. ACS Synth Biol. 2015). Homologous region amplified from EasyClone-MarkerFree toolkit (Jessop-Fabre et al. Biotechnol J. 2016). Vector Backbone:pYTK001; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol 2026-07-25 12:43:19 0
pMC7-XI2dw
 
Resource Report
Resource Website 		RRID:Addgene_176169 3' homology for integration site XI-2 Saccharomyces cerevisiae Chloramphenicol PMID:34860007 Constructed using the Yeast Modular Cloning Toolkit (Lee et al. ACS Synth Biol. 2015). Homologous region amplified from EasyClone-MarkerFree toolkit (Jessop-Fabre et al. Biotechnol J. 2016). Vector Backbone:pYTK001; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol 2026-07-25 12:43:19 0
pMC3-TPK2
 
Resource Report
Resource Website 		RRID:Addgene_176180 TPK2 Saccharomyces cerevisiae Chloramphenicol PMID:34860007 Constructed using the Yeast Modular Cloning Toolkit (Lee et al. ACS Synth Biol. 2015). Vector Backbone:pYTK001; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol 2026-07-25 12:43:20 0
pMC3-yeGFP
 
Resource Report
Resource Website 		RRID:Addgene_176181 yEGFP Aequorea victoria Chloramphenicol PMID:34860007 Constructed using the Yeast Modular Cloning Toolkit (Lee et al. ACS Synth Biol. 2015). yEGFP gene from Kaishima, M. et al Sci Rep 2016. Vector Backbone:pYTK001; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol 2026-07-25 12:43:20 0
pMCL8
 
Resource Report
Resource Website 		RRID:Addgene_176184 Chloramphenicol PMID:34860007 Constructed using the Yeast Modular Cloning Toolkit (Lee et al. ACS Synth Biol. 2015). 5' cloning site: BsmBI (destroyed during cloning), 3' cloning site: BsmBI (destroyed during cloning). Vector Backbone:pYTK001; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol 2026-07-25 12:43:20 0
pMCL8_28bp
 
Resource Report
Resource Website 		RRID:Addgene_176185 Chloramphenicol PMID:34860007 Vector Backbone:pMCL8; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol 2026-07-25 12:43:20 0
3927-64
 
Resource Report
Resource Website 		RRID:Addgene_176500 EGFP-T2A-TFEB(human; delta30; amino acids 31-476) Homo sapiens Chloramphenicol PMID:29507340 Vector Backbone:pCamR; Vector Types:Mammalian Expression; Bacterial Resistance:Chloramphenicol 2026-07-25 12:43:23 0
3919-32
 
Resource Report
Resource Website 		RRID:Addgene_176496 puroR-T2A-TetOn3G Chloramphenicol PMID:29507340 Addgene QC identified a P93S difference in the PuroR selectable marker that the depositing lab does not believe to affect function. Vector Backbone:pCamR; Vector Types:Mammalian Expression; Bacterial Resistance:Chloramphenicol 2026-07-25 12:43:23 0
3924-55
 
Resource Report
Resource Website 		RRID:Addgene_176499 EGFP-T2A-TFEB(human; full-length; S3E mutation)- Homo sapiens Chloramphenicol PMID:29507340 Vector Backbone:pCamR; Vector Types:Mammalian Expression; Bacterial Resistance:Chloramphenicol 2026-07-25 12:43:23 0
pACYC-T7CyDisCo
 
Resource Report
Resource Website 		RRID:Addgene_176405 Mitochondrial FAD-linked sulfhydryl oxidase Saccharomyces cerevisiae Chloramphenicol Please visit https://www.biorxiv.org/content/10.1101/2021.08.31.458447v1 for bioRxiv preprint. Backbone Size:5068; Vector Backbone:pACYC184-TU2A-RFP; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol Codon optimised for expression in E. coli 2026-07-25 12:43:22 0
pACYC-T7FunCyDisCo
 
Resource Report
Resource Website 		RRID:Addgene_176404 FAD-linked sulfhydryl oxidase ERV2 from Fol Other Chloramphenicol Please visit https://www.biorxiv.org/content/10.1101/2021.08.31.458447v1 for bioRxiv preprint. Backbone Size:5068; Vector Backbone:pACYC184-TU2A-RFP; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol deleted amino acids 2-25, codon optimised for E. coli expression 2026-07-25 12:43:22 0
BL21 Rosetta2 ΔrecBCD
 
Resource Report
Resource Website 		RRID:Addgene_176583 pRARE2 plasmid Chloramphenicol PMID:35034449 Please visit https://www.biorxiv.org/content/10.1101/2021.09.07.459228v1 for bioRxiv preprint. Primers for recBCD deletion verification: Foward - ttgatttactgcccgagagc Reverse - gtcaaccgaatgcagacatc Vector Backbone:Strain; Vector Types:; Bacterial Resistance:Chloramphenicol recBCD genomic deletion 2026-07-25 12:43:23 0
BL21 Rosetta2 ΔrecB
 
Resource Report
Resource Website 		RRID:Addgene_176582 pRARE2 plasmid Chloramphenicol PMID:35034449 Please visit https://www.biorxiv.org/content/10.1101/2021.09.07.459228v1 for bioRxiv preprint. Primers for recB deletion verification: Foward - tattttccagtcgtgaaagc Reverse - ttgctgatttcttccatcag Vector Backbone:Strain; Vector Types:; Bacterial Resistance:Chloramphenicol recB genomic deletion 2026-07-25 12:43:23 0
pYCTK030
 
Resource Report
Resource Website 		RRID:Addgene_176734 bar1Ca Candida albicans Chloramphenicol The gene was codon-optimized for expression in S. cervisiae and cloned into the vector using Goden Gate. The plasmid is Golden Gate Cloning compatible. Please visit https://doi.org/10.1101/2021.09.27.462023 for bioRxiv preprint. Vector Backbone:pYTK001; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol Codon-optimized for expression in S. cerevisiae 2026-07-25 12:43:25 0
pYCTK033
 
Resource Report
Resource Website 		RRID:Addgene_176737 bar1Kn Kazachstania naganishii Chloramphenicol The gene was codon-optimized for expression in S. cervisiae and cloned into the vector using Goden Gate. The plasmid is Golden Gate Cloning compatible. Please visit https://doi.org/10.1101/2021.09.27.462023 for bioRxiv preprint. Vector Backbone:pYTK001; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol Codon-optimized for expression in S. cerevisiae 2026-07-25 12:43:25 0
pYCTK032
 
Resource Report
Resource Website 		RRID:Addgene_176736 bar1Kl Kluyveromyces lactis Chloramphenicol The gene was codon-optimized for expression in S. cervisiae and cloned into the vector using Goden Gate. The plasmid is Golden Gate Cloning compatible. Please visit https://doi.org/10.1101/2021.09.27.462023 for bioRxiv preprint. Vector Backbone:pYTK001; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol Codon-optimized for expression in S. cerevisiae 2026-07-25 12:43:25 0
pYCTK027
 
Resource Report
Resource Website 		RRID:Addgene_176731 ste2Sc Saccharomyces cerevisiae Chloramphenicol The gene was codon-optimized for expression in S. cervisiae and cloned into the vector using Goden Gate. The plasmid is Golden Gate Cloning compatible. Please visit https://doi.org/10.1101/2021.09.27.462023 for bioRxiv preprint. Vector Backbone:pYTK001; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol 2026-07-25 12:43:25 0
pYCTK026
 
Resource Report
Resource Website 		RRID:Addgene_176730 ste2Lt Lachancea thermotolerans Chloramphenicol The gene was codon-optimized for expression in S. cervisiae and cloned into the vector using Goden Gate. The plasmid is Golden Gate Cloning compatible. Please visit https://doi.org/10.1101/2021.09.27.462023 for bioRxiv preprint. Vector Backbone:pYTK001; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol Codon-optimized for expression in S. cerevisiae 2026-07-25 12:43:25 0
pYCTK019
 
Resource Report
Resource Website 		RRID:Addgene_176723 ste2Ca Candida albicans Chloramphenicol The gene was codon-optimized for expression in S. cervisiae and cloned into the vector using Goden Gate. The plasmid is Golden Gate Cloning compatible. Please visit https://doi.org/10.1101/2021.09.27.462023 for bioRxiv preprint. Vector Backbone:pYTK001; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol Codon-optimized for expression in S. cerevisiae 2026-07-25 12:43:25 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. Kravitz Dataset 2 Resources

    Welcome to the kravitz2 Resources search. From here you can search through a compilation of resources used by kravitz2 and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that kravitz2 has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on kravitz2 then you can log in from here to get additional features in kravitz2 such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into kravitz2 you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Data set from Kravitz, Owen and Kretizer's 2012 paper "Optogenetic identification of striatal projection neuron subtypes during in vivo recordings."

Recent News Entries

Kravitz Dataset 2

Contact Us

E [email protected]

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch