Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Mentions:yes (facet)

Facets

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

30,971 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
p156RRL-EF1a-GFP-U3H1SatA
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_41795 satellite repeat sequence Ampicillin PMID:21901007 Vector Backbone:p156RRLsinpptCAGPRE; Vector Types:; Bacterial Resistance:Ampicillin 2026-07-25 12:46:55 1
pCD/NL-BH∆1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_41791 HIV-1 Gag/Pol and RRE sequences Ampicillin PMID:22612657 Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-07-25 12:46:55 2
EcNR2.dnaG.Q576A
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_41700 E. coli MG1655 ΔmutS::cat Δ(ybhB-bioAB)::[λcI857 N(cro-ea59)::tetR-bla] dnaG.Q576A Ampicillin PMID:22904085 Vector Backbone:genome; Vector Types:; Bacterial Resistance:Ampicillin 2026-07-25 12:46:55 3
hCas9
 
Resource Report
Resource Website
100+ mentions 		RRID:Addgene_41815 Cas9 Ampicillin PMID:23287722 For additional information: http://arep.med.harvard.edu/human_crispr/ Backbone Marker:Invitrogen; Vector Backbone:pcDNA3.3-TOPO; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin human codon-optimized 2026-07-25 12:46:55 448
pCE-hSK
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_41814 SOX2, KLF4 Homo sapiens Ampicillin PMID:23193063 Backbone Size:9364; Vector Backbone:pCE; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-07-25 12:46:55 47
gRNA_AAVS1-T2
 
Resource Report
Resource Website
50+ mentions 		RRID:Addgene_41818 gRNA_AAVS1-T2 Kanamycin PMID:23287722 gRNA target sequence GGGGCCACTAGGGACAGGAT Backbone Marker:Invitrogen; Vector Backbone:pCR-Blunt II-TOPO; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Kanamycin 2026-07-25 12:46:55 51
gRNA_AAVS1-T1
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_41817 gRNA_AAVS1-T1 Kanamycin PMID:23287722 gRNA target sequence GTCCCCTCCACCCCACAGTG Backbone Marker:Invitrogen; Vector Backbone:pCR-Blunt II-TOPO; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Kanamycin 2026-07-25 12:46:55 13
HA-EGFP-HaloTag2
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_41742 Halotag 2 Homo sapiens Ampicillin PMID:21725302 Alternate plasmid name: pCDNA5-KGH2 Backbone Marker:INVITROGEN; Backbone Size:5000; Vector Backbone:PCDNA5; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Ampicillin 2026-07-25 12:46:55 5
Nuc5-.dnaG.Q576A.tolC-
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_41699 E. coli MG1655 ΔmutS::cat Δ(ybhB-bioAB)::[λcI857 N(cro-ea59)::tetR-bla] xonA-, recJ-,xseA-, exoX- and redα- dnaG.Q576A tolC- Ampicillin PMID:22904085 Vector Backbone:genome; Vector Types:; Bacterial Resistance:Ampicillin 2026-07-25 12:46:55 1
pCS2 Notch1 ICv-6MT
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_41730 Notch-1 Intracellular Domain Mus musculus Ampicillin PMID:9620803 Alternate plasmid name: pCS2 NICv1744-6MT To create pCS2+ NICV1744, the primer CCAGGATCCACCATGGTGCTGCTGTCCCGCAAGC was used with primer M95 (5'-TCGAACATTGACATCCATGCA-3') to generate a product that was digested with Bam HI and Bcl I, and ligated into the same sites in NΔE (Addgene plasmid #41737). Backbone Size:4352; Vector Backbone:pCS2+MT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Contains murine Notch-1 protein beginning at Valine 1744 (aa 1744-2184) 2026-07-25 12:46:55 3
pSKDuet21
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_41695 PhoCDC21-1 intein Pyrococcus horikoshii Kanamycin PMID:22001202 Backbone Marker:novagen; Vector Backbone:pRSFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-07-25 12:46:54 1
pBABE puro Brca1 S1423A S1524A HA
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_41968 BRCA1 Homo sapiens Ampicillin PMID:10550055 The BRCA1 insert in this plasmid contains the following common polymorphisms when compared to GenBank reference sequence NP_009225.1: P871L, E1038G, K1182R, and S1613G. These SNPs were likely present in the original cDNA isolate. Backbone Size:5200; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin S1423A, S1524A 2026-07-25 12:46:56 1
pCT302
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_41845 4-4-20 Synthetic Ampicillin PMID:15465055 Backbone Size:6142; Vector Backbone:pCT; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-07-25 12:46:55 6
pCT-4M5.3
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_41844 4M5.3 Synthetic Ampicillin PMID:15465055 Backbone Size:6142; Vector Backbone:pCT; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-07-25 12:46:55 1
MSCV-CMV-DsRed-IRES-d24EGFP
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_41944 DsRed Ampicillin PMID:18988847 24 hour half life EGFP Vector Backbone:MSCV; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-07-25 12:46:56 2
MSCV-CMV-DsRed-IRES-d1EGFP
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_41942 DsRed Ampicillin PMID:18988847 1 hour half life EGFP Backbone Size:7556; Vector Backbone:MSCV; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-07-25 12:46:56 1
pDZ50
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_41948 ubiquitin specific peptidase 28 Homo sapiens Kanamycin PMID:16901786 Backbone Size:4261; Vector Backbone:phCMV2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-07-25 12:46:56 2
pAG306-GPD-ccdB chr I
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_41894 Chloramphenicol and Ampicillin PMID:23172144 This plasmid was generated by ligation of a SmaI-digested fusion PCR product that contained two ~500-base-pair regions of chromosome 1 flanking a NotI site into AatII-digested pAG306-GPD-ccdB. Backbone Marker:Susan Lindquist (Addgene plasmid# 14140); Backbone Size:6972; Vector Backbone:pAG306GPD-ccdB; Vector Types:Yeast Expression; Bacterial Resistance:Chloramphenicol and Ampicillin 2026-07-25 12:46:56 1
MSCV-PM BRD7 sh1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_41927 BRD7 Homo sapiens Ampicillin PMID:20660729 Backbone Size:7556; Vector Backbone:MSCV; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-07-25 12:46:56 1
pHAGE DN Cullin2
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_41912 CUL2 Homo sapiens Ampicillin PMID:21963094 Backbone Size:8000; Vector Backbone:pHAGE; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin 2026-07-25 12:46:56 3

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. Kravitz Dataset 2 Resources

    Welcome to the kravitz2 Resources search. From here you can search through a compilation of resources used by kravitz2 and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that kravitz2 has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on kravitz2 then you can log in from here to get additional features in kravitz2 such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into kravitz2 you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Data set from Kravitz, Owen and Kretizer's 2012 paper "Optogenetic identification of striatal projection neuron subtypes during in vivo recordings."

Recent News Entries

Kravitz Dataset 2

Contact Us

E [email protected]

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch