Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 26 showing 501 ~ 520 out of 742,581 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_208642

http://www.addgene.org/208642

Vector Backbone Description: Vector Backbone:pUC19; Vector Types:Long single strand DNA production; Bacterial Resistance:Ampicillin
Comments: Note that this is only a pUC19 removed indicated intrisic enzyme site, BspQI or BsrDI needed for ssDNA preparation need to be introduced together with the inserts. Mutations were introduced as discribed in "https://www.neb.com/-/media/nebus/files/application-notes/appnote_improved_methods_for_sdm_using_nebuilder_hifi_dna_assembly_master_mix.pdf" >mutagenesis_primers pUC-ΔBts592-F: 5' CGTTGCGCTCACAGCCCGCTTTCCAG 3' pUC-ΔBts592-R: 5' CTGGAAAGCGGGCTGTGAGCGCAACG 3' pUC-ΔBspQ690-F: 5' GTATTGGGCGCTGTTCCGCTTCCTC 3' pUC-ΔBspQ690-R: 5' GAGGAAGCGGAACAGCGCCCAATAC 3' pUC-ΔBsrD1760-F: 5' CAGTGCTGCAATAATACCGCGAGACC 3' pUC-ΔBsrD1760-R: 5' GGTCTCGCGGTATTATTGCAGCACTG 3' pUC-ΔBsrD1934-F: 5' CGTTGTTGCCATAGCTACAGGCATCGTG 3' pUC-ΔBsrD1934-R: 5' CACGATGCCTGTAGCTATGGCAACAACG 3' pUC-ΔBts2099&2119-F: 5' CCGCTGTGTTATCACTCATGGTTATGGCAGCACTACATAATTCTC 3' pUC-ΔBts2099&2119-R: 5' TATGTAGTGCTGCCATAACCATGAGTGATAACACAGCGGCCAAC 3'

Proper citation: RRID:Addgene_208642 Copy   


http://www.addgene.org/211534

Species: Synthetic
Genetic Insert: sgATG7
Vector Backbone Description: Vector Backbone:pLentiCRISPR-v2; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39592843

Proper citation: RRID:Addgene_211534 Copy   


  • RRID:Addgene_208938

http://www.addgene.org/208938

Species: Schmallenberg orthobunyavirus
Genetic Insert: NSs
Vector Backbone Description: Backbone Marker:Tony Pawson; Backbone Size:4195; Vector Backbone:V27 pLPS-3' HA - Acceptor; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin

Proper citation: RRID:Addgene_208938 Copy   


  • RRID:Addgene_208934

http://www.addgene.org/208934

Species: Other
Genetic Insert: NSs
Vector Backbone Description: Backbone Marker:Christopher A Walsh; Backbone Size:3800; Vector Backbone:pCMV-HA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_208934 Copy   


  • RRID:Addgene_208935

http://www.addgene.org/208935

Species: Oropouche orthobunyavirus
Genetic Insert: NSm
Vector Backbone Description: Backbone Marker:Christopher A Walsh; Backbone Size:3800; Vector Backbone:pCMV-HA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_208935 Copy   


  • RRID:Addgene_208936

http://www.addgene.org/208936

Species: Oropouche orthobunyavirus
Genetic Insert: Gc
Vector Backbone Description: Backbone Marker:Christopher A Walsh; Backbone Size:3800; Vector Backbone:pCMV-HA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_208936 Copy   


  • RRID:Addgene_208937

http://www.addgene.org/208937

Species: Oropouche orthobunyavirus
Genetic Insert: Nucleocapsid
Vector Backbone Description: Backbone Marker:Christopher A Walsh; Backbone Size:3800; Vector Backbone:pCMV-HA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_208937 Copy   


  • RRID:Addgene_208933

http://www.addgene.org/208933

Species: Other
Genetic Insert: Gc
Vector Backbone Description: Backbone Marker:Christopher A Walsh; Backbone Size:3800; Vector Backbone:pCMV-HA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_208933 Copy   


http://www.addgene.org/208383

Species: Mus musculus
Genetic Insert: sgControl (TP53BP1 intron)
Vector Backbone Description: Vector Backbone:LentiCRISPR V2-Cre-NLuc; Vector Types:Mammalian Expression, Lentiviral, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38200309

Proper citation: RRID:Addgene_208383 Copy   


http://www.addgene.org/208384

Species: Mus musculus
Genetic Insert: sgMRE11
Vector Backbone Description: Vector Backbone:LentiCRISPR V2-Cre-NLuc; Vector Types:Mammalian Expression, Lentiviral, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38200309

Proper citation: RRID:Addgene_208384 Copy   


  • RRID:Addgene_209191

    This resource has 1+ mentions.

http://www.addgene.org/209191

Species: Medicago truncatula
Genetic Insert: MtU6-26 SnRNA promoter
Vector Backbone Description: Vector Backbone:pUC18; Vector Types:Cloning Vector; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_209191 Copy   


  • RRID:Addgene_204347

http://www.addgene.org/204347

Species: Synthetic
Genetic Insert: TopFlash-NanoLucP
Vector Backbone Description: Backbone Marker:n/a; Vector Backbone:piggybac; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37949072

Proper citation: RRID:Addgene_204347 Copy   


http://www.addgene.org/212805

Species: Homo sapiens
Genetic Insert: NUbo-E3(48)-mCherry-P2A-3xFLAG-Ubc7
Vector Backbone Description: Vector Backbone:pcDNA5-FRT/TO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38103558
Comments: pHU5705; codon-optimized for mammalian cells

Proper citation: RRID:Addgene_212805 Copy   


  • RRID:Addgene_204583

http://www.addgene.org/204583

Species: Homo sapiens
Genetic Insert: lamin A (565-646)
Vector Backbone Description: Backbone Size:4939; Vector Backbone:pGEX4t1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37219077

Proper citation: RRID:Addgene_204583 Copy   


http://www.addgene.org/208387

Species: Mus musculus
Genetic Insert: sgZBP1
Vector Backbone Description: Vector Backbone:LentiCRISPR V2-Cre-NLuc; Vector Types:Mammalian Expression, Lentiviral, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38200309

Proper citation: RRID:Addgene_208387 Copy   


  • RRID:Addgene_204588

http://www.addgene.org/204588

Species: Homo sapiens
Genetic Insert: human lamin A (389-597)
Vector Backbone Description: Backbone Size:4939; Vector Backbone:pGEX4t1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37219077

Proper citation: RRID:Addgene_204588 Copy   


http://www.addgene.org/208389

Species: Mus musculus
Genetic Insert: sgZBP1
Vector Backbone Description: Vector Backbone:LentiCRISPR V2-Cre-NLuc; Vector Types:Mammalian Expression, Lentiviral, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38200309

Proper citation: RRID:Addgene_208389 Copy   


  • RRID:Addgene_204586

http://www.addgene.org/204586

Species: Homo sapiens
Genetic Insert: lamin A (389-626)
Vector Backbone Description: Backbone Size:4939; Vector Backbone:pGEX4t1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37219077

Proper citation: RRID:Addgene_204586 Copy   


http://www.addgene.org/208394

Species: Homo sapiens
Genetic Insert: Human MRE11
Vector Backbone Description: Vector Backbone:pBABE-Puro-Halo; Vector Types:Mammalian Expression, Retroviral, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38200309

Proper citation: RRID:Addgene_208394 Copy   


  • RRID:Addgene_208396

http://www.addgene.org/208396

Species: Homo sapiens
Genetic Insert: Human cGAS
Vector Backbone Description: Vector Backbone:PB-TA-ERP2; Vector Types:Mammalian Expression, PiggyBac Transposon; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38200309

Proper citation: RRID:Addgene_208396 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. Kravitz Dataset 2 Resources

    Welcome to the kravitz2 Resources search. From here you can search through a compilation of resources used by kravitz2 and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that kravitz2 has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on kravitz2 then you can log in from here to get additional features in kravitz2 such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into kravitz2 you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within kravitz2 that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X