Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 24 showing 461 ~ 480 out of 742,877 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_181775

http://www.addgene.org/181775

Species: humanized S. pyogenes Cas9
Genetic Insert: Slc17a7 guide
Vector Backbone Description: Backbone Marker:Feng Zhang; Vector Backbone:pX330 ; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_181775 Copy   


  • RRID:Addgene_181774

http://www.addgene.org/181774

Species: humanized S. pyogenes Cas9
Genetic Insert: Sncg guide
Vector Backbone Description: Backbone Marker:Feng Zhang; Vector Backbone:pX330 ; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_181774 Copy   


http://www.addgene.org/182588

Species: Homo sapiens
Genetic Insert: hTRF1
Vector Backbone Description: Backbone Size:1314; Vector Backbone:pHAGE2; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32497497
Comments: Please note: This plasmid contains an E296D mutation hTRF1. This mutation is not known to affect plasmid function.

Proper citation: RRID:Addgene_182588 Copy   


  • RRID:Addgene_210629

http://www.addgene.org/210629

Species: Homo sapiens
Genetic Insert: promoter 1-3
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4283; Vector Backbone:pGL4.23[luc2/minP]; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37379322
Comments: A 19 bp insertion between insert and backbone sequence was found.

Proper citation: RRID:Addgene_210629 Copy   


  • RRID:Addgene_205315

    This resource has 1+ mentions.

http://www.addgene.org/205315

Species: Synthetic
Genetic Insert: CaMKAR
Vector Backbone Description: Backbone Size:5408; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37343080

Proper citation: RRID:Addgene_205315 Copy   


http://www.addgene.org/212126

Species: Bradyrhizobium tropiciagri SEMIA 6148
Genetic Insert: Bradyrhizobium bGSDM
Vector Backbone Description: Backbone Marker:custom; Backbone Size:5932; Vector Backbone:pETSUMO2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35025633

Proper citation: RRID:Addgene_212126 Copy   


http://www.addgene.org/181760

Species: Synthetic
Genetic Insert: nls-tagged EGFP and nls-tagged dTomato
Vector Backbone Description: Vector Backbone:TIGRE3.0 targeting vector; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin

Proper citation: RRID:Addgene_181760 Copy   


  • RRID:Addgene_208053

http://www.addgene.org/208053

Vector Backbone Description: Backbone Marker:Merck-Millipore (Novagen); Vector Backbone:pET28a(+); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: We optimized nucleic acid sequence of Twin Strep, eliminated tandem repeats, for better oligo assembly. The nucleic acids are different from that of IBA lifescience, amino acids are the same. The Twin Strep tag was synthesized by oligo assembly using following oligos: # Sequence 5'-3' bp pET28-TwStrp.o1: CGACAAGCTTTCCGGAGGGAGCGCTTGGAGCCACCCGCAGTTCGAA 46 pET28-TwStrp.o2: CGATCCACCGCCAGAACCTCCACCTTTTTCGAACTGCGGGTGGCTC 46 TwStrp.opt.o3: AGGTTCTGGCGGTGGATCGGGAGGTTCAGCGTGGTCTCACCCCCAA 46 TwStrp.opt.o4: GGTGCTCGAGCTATTACTTCTCAAATTGGGGGTGAGACCACGCT 44

Proper citation: RRID:Addgene_208053 Copy   


http://www.addgene.org/181762

Species: Synthetic
Genetic Insert: GCaMP7s and tTA2
Vector Backbone Description: Vector Backbone:TIGRE3.0 targeting vector; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin

Proper citation: RRID:Addgene_181762 Copy   


http://www.addgene.org/181761

Species: Synthetic
Genetic Insert: nls-tagged EGFP and tdTomato
Vector Backbone Description: Vector Backbone:TIGRE3.0 targeting vector; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin

Proper citation: RRID:Addgene_181761 Copy   


  • RRID:Addgene_208051

    This resource has 10+ mentions.

http://www.addgene.org/208051

Vector Backbone Description: Backbone Marker:Thermo Fisher (Invitrogen); Backbone Size:5427; Vector Backbone:pcDNA3.1 (-); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_208051 Copy   


  • RRID:Addgene_208052

http://www.addgene.org/208052

Species: Homo sapiens
Genetic Insert: human RBM24 (ENST00000379052) coding region
Vector Backbone Description: Backbone Marker:Thermo Fisher (invitrogen); Vector Backbone:pcDNA3.1-Flag; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_208052 Copy   


http://www.addgene.org/181763

Species: Synthetic
Genetic Insert: GCaMP7f and tTA2
Vector Backbone Description: Vector Backbone:TIGRE3.0 targeting vector; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin

Proper citation: RRID:Addgene_181763 Copy   


  • RRID:Addgene_181769

http://www.addgene.org/181769

Species: humanized S. pyogenes Cas9
Genetic Insert: Ctxn3 guide
Vector Backbone Description: Backbone Marker:Feng Zhang; Vector Backbone:pX330 ; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_181769 Copy   


  • RRID:Addgene_212718

    This resource has 1+ mentions.

http://www.addgene.org/212718

Species: Homo sapiens
Genetic Insert: GFP
Vector Backbone Description: Vector Backbone:pET24a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:38103558
Comments: pHU5332

Proper citation: RRID:Addgene_212718 Copy   


  • RRID:Addgene_212717

    This resource has 1+ mentions.

http://www.addgene.org/212717

Species: Homo sapiens
Genetic Insert: E3(63)
Vector Backbone Description: Vector Backbone:pET24a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:38103558
Comments: pHU3226

Proper citation: RRID:Addgene_212717 Copy   


  • RRID:Addgene_208616

    This resource has 1+ mentions.

http://www.addgene.org/208616

Vector Backbone Description: Backbone Marker:Thermo Fisher (Invitrogen); Vector Backbone:pcDNA3.1 (-); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_208616 Copy   


  • RRID:Addgene_212716

    This resource has 1+ mentions.

http://www.addgene.org/212716

Species: Saccharomyces cerevisiae
Genetic Insert: Mms2
Vector Backbone Description: Vector Backbone:pET30; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:38103558
Comments: pHU2807

Proper citation: RRID:Addgene_212716 Copy   


  • RRID:Addgene_201307

http://www.addgene.org/201307

Species: Triticum aestivum
Genetic Insert: Sr27
Vector Backbone Description: Vector Backbone:pAGM9121; Vector Types:Plant Expression; Bacterial Resistance:Spectinomycin

Proper citation: RRID:Addgene_201307 Copy   


  • RRID:Addgene_201306

http://www.addgene.org/201306

Species: Triticum aestivum
Genetic Insert: D16: Promoter of TraesCS5D02G320700
Vector Backbone Description: Vector Backbone:pAGM9121; Vector Types:Plant Expression; Bacterial Resistance:Spectinomycin

Proper citation: RRID:Addgene_201306 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. Kravitz Dataset 2 Resources

    Welcome to the kravitz2 Resources search. From here you can search through a compilation of resources used by kravitz2 and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that kravitz2 has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on kravitz2 then you can log in from here to get additional features in kravitz2 such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into kravitz2 you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within kravitz2 that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X