Plasmids   Select Another Resource Report Type

http://www.addgene.org/174669

Vector Backbone Description: Backbone Marker:Promega; Backbone Size:3730; Vector Backbone:pGL4.10; Vector Types:Enhancer reporter; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34874265

Proper citation: RRID:Addgene_174669 Copy   

•   Source: Addgene

http://www.addgene.org/17470

Genetic Insert: Enhanced green fluorescent protein shRNA #1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2555; Vector Backbone:pENTR1A; Vector Types:RNAi, Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:19657394
Comments: shRNA oligo sequence 5'-CGAAGCAGCACGACTTCTTCTTCAAGAGAGAAGAAGTCGTGCTGCTTCTTTTT

Proper citation: RRID:Addgene_17470 Copy   

•   Source: Addgene

http://www.addgene.org/17460

Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3030; Vector Backbone:pENTR1A; Vector Types:Mammalian Expression, Bacterial Expression, Yeast Expression, Insect Expression, Plant Expression, modified Gateway Entry vector; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18211686
Comments: Part of a modified Gateway Entry vector system for generating epitope tagged constructs. Clone your gene of interest into this vector using the BamHI and NotI cloning sites to obtain a N-terminal EYFP tagged Entry vector. The resulting Entry vector can be recombined into Gateway Destination vectors for bacteria, insect mammalian, plant or yeast expression via the Gateway LR reaction. The tag is present in the Entry cassette to avoid the presence of att-derived protein linker sequences between the tag and gene or interest corresponding to the attB recombination site. A stop codon is already present within the vector (see plasmid map). GenBank accession number: EU344821

Proper citation: RRID:Addgene_17460 Copy   

•   Source: Addgene

http://www.addgene.org/17462

Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2426; Vector Backbone:pENTR1A; Vector Types:Mammalian Expression, Bacterial Expression, Yeast Expression, Insect Expression, Plant Expression, modified Gateway Entry vector; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18211686
Comments: Part of a modified Gateway Entry vector system for generating epitope tagged constructs. Clone your gene of interest into this vector using the BamHI and NotI cloning sites to obtain a C-terminal 3x HA tagged Entry vector. The resulting Entry vector can be recombined into Gateway Destination vectors for bacteria, insect mammalian, plant or yeast expression via the Gateway LR reaction. The tag is present in the Entry cassette to avoid the presence of att-derived protein linker sequences between the tag and gene or interest corresponding to the attB recombination site. A stop codon is already present within the vector (see plasmid map). GenBank accession number: EU344823

Proper citation: RRID:Addgene_17462 Copy   

•   Source: Addgene

http://www.addgene.org/17464

Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2972; Vector Backbone:pENTR1A; Vector Types:Mammalian Expression, Bacterial Expression, Yeast Expression, Insect Expression, Plant Expression, modified Gateway Entry vector; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18211686
Comments: Part of a modified Gateway Entry vector system for generating epitope tagged constructs. Clone your gene of interest into this vector using the BamHI and NotI cloning sites to obtain a C-terminal GST tagged Entry vector. The resulting Entry vector can be recombined into Gateway Destination vectors for bacteria, insect mammalian, plant or yeast expression via the Gateway LR reaction. The tag is present in the Entry cassette to avoid the presence of att-derived protein linker sequences between the tag and gene or interest corresponding to the attB recombination site. A stop codon is already present within the vector (see plasmid map). GenBank accession number: EU344826

Proper citation: RRID:Addgene_17464 Copy   

•   Source: Addgene

http://www.addgene.org/17465

Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3023; Vector Backbone:pENTR1A; Vector Types:Mammalian Expression, Bacterial Expression, Yeast Expression, Insect Expression, Plant Expression, modified Gateway Entry vector; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18211686
Comments: Part of a modified Gateway Entry vector system for generating epitope tagged constructs. Clone your gene of interest into this vector using the BamHI and NotI cloning sites to obtain a C-terminal ECFP tagged Entry vector. The resulting Entry vector can be recombined into Gateway Destination vectors for bacteria, insect mammalian, plant or yeast expression via the Gateway LR reaction. The tag is present in the Entry cassette to avoid the presence of att-derived protein linker sequences between the tag and gene or interest corresponding to the attB recombination site. A stop codon is already present within the vector (see plasmid map). GenBank accession number: EU344826

Proper citation: RRID:Addgene_17465 Copy   

•   Source: Addgene

http://www.addgene.org/174665

Species: Synthetic
Genetic Insert: LUC2
Vector Backbone Description: Backbone Marker:VectorBuilder; Vector Backbone:pLV; Vector Types:Mammalian Expression, Lentiviral, Luciferase; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_174665 Copy   

•   Source: Addgene

http://www.addgene.org/17468

Species: Homo sapiens
Genetic Insert: Bnip3L RNAi
Vector Backbone Description: Backbone Size:6349; Vector Backbone:pSuper-retro; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15607964
Comments: Target sequence: AACAGTTCCTGGGTGGAGCTA

Proper citation: RRID:Addgene_17468 Copy   

•   Source: Addgene

http://www.addgene.org/174618

Species: Synthetic
Genetic Insert: mtrCAB
Vector Backbone Description: Backbone Size:3903; Vector Backbone:pET-28a; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin
Comments: Please note MtrC starts at amino acid 75. Depositor confirms this is not a concern.

Proper citation: RRID:Addgene_174618 Copy   

•   Source: Addgene

http://www.addgene.org/174692

Species: Staphylococcus aureus and Escherichia coli
Genetic Insert: Anti-HER2 affibody ZHER2:342 fused to mutated form of BirA, BirA*
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:7382; Vector Backbone:pET301/NT-DEST; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36742360

Proper citation: RRID:Addgene_174692 Copy   

•   Source: Addgene

http://www.addgene.org/174610

Species: Homo sapiens
Genetic Insert: human CD19, antigen minigene
Vector Backbone Description: Vector Backbone:MP71; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34396986

Proper citation: RRID:Addgene_174610 Copy   

•   Source: Addgene

http://www.addgene.org/174608

Genetic Insert: membrane GFP fused to LLO and mouse PMEL antigen
Vector Backbone Description: Vector Backbone:mp71; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34396986

Proper citation: RRID:Addgene_174608 Copy   

•   Source: Addgene

http://www.addgene.org/174602

Genetic Insert: Constitutive expression of secreted murine IFN gamma
Vector Backbone Description: Vector Backbone:mp71; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34396986

Proper citation: RRID:Addgene_174602 Copy   

•   Source: Addgene

http://www.addgene.org/174603

Genetic Insert: extracell transmem domains moCD19 wCterm fusion LLO190 and minigenes of 3neoantigens MC38tumor in genes ADGPK DPAGT Reps1
Vector Backbone Description: Vector Backbone:mp71; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34396986

Proper citation: RRID:Addgene_174603 Copy   

•   Source: Addgene

http://www.addgene.org/174605

Genetic Insert: palmytoylGFP w/C-term fusion LLO190 and minigenes of 2 neoantigens from the T3 tumor in genes Alg8 Lama4
Vector Backbone Description: Vector Backbone:mp71; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34396986

Proper citation: RRID:Addgene_174605 Copy   

•   Source: Addgene

http://www.addgene.org/174682

Species: Prevotella disiens
Genetic Insert: huPdCas12a
Vector Backbone Description: Backbone Marker:Scott Gradia Lab; Backbone Size:6462; Vector Backbone:pET; Vector Types:Bacterial Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Kanamycin
Comments: The vector is obtained from Scott Gradia Lab (Addgene #29656) while the gene is obtained from Feng Zhang Lab (Addgene #69990) . Read the preprint on medRxiv here: https://www.medrxiv.org/content/10.1101/2021.07.21.21260653v1

Proper citation: RRID:Addgene_174682 Copy   

•   Source: Addgene

http://www.addgene.org/174685

Species: Eubacterium rectale
Genetic Insert: huErCas12a
Vector Backbone Description: Backbone Marker:Scott Gradia Lab; Backbone Size:6462; Vector Backbone:pET; Vector Types:Bacterial Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Kanamycin
Comments: The vector is obtained from Scott Gradia Lab (Addgene #29656) while the gene is obtained from Stephen Ekker Lab (Addgene #132641) . Read the preprint on medRxiv here: https://www.medrxiv.org/content/10.1101/2021.07.21.21260653v1

Proper citation: RRID:Addgene_174685 Copy   

•   Source: Addgene

http://www.addgene.org/174686

Species: Prevotella bryantii B14
Genetic Insert: huPb2Cas12a
Vector Backbone Description: Backbone Marker:Scott Gradia Lab; Backbone Size:6462; Vector Backbone:pET; Vector Types:Bacterial Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Kanamycin
Comments: The vector is obtained from Scott Gradia Lab (Addgene #29656) while the gene is obtained from Feng Zhang Lab (Addgene #92272) . Read the preprint on medRxiv here: https://www.medrxiv.org/content/10.1101/2021.07.21.21260653v1

Proper citation: RRID:Addgene_174686 Copy   

•   Source: Addgene

http://www.addgene.org/174687

Species: Thiomicrospira sp. XS5
Genetic Insert: huTsCas12a
Vector Backbone Description: Backbone Marker:Scott Gradia Lab; Backbone Size:6462; Vector Backbone:pET; Vector Types:Bacterial Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Kanamycin
Comments: The vector is obtained from Scott Gradia Lab (Addgene #29656) while the gene is obtained from Feng Zhang Lab (Addgene #92267) . Read the preprint on medRxiv here: https://www.medrxiv.org/content/10.1101/2021.07.21.21260653v1

Proper citation: RRID:Addgene_174687 Copy   

•   Source: Addgene

http://www.addgene.org/174634

Species: Mus musculus
Genetic Insert: KIF1A(1-365)-VVDfast-mCherry-SSPB(micro)
Vector Backbone Description: Vector Backbone:B-actin; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32328628
Comments: Internal plasmid ID: WN444

Proper citation: RRID:Addgene_174634 Copy   

•   Source: Addgene