Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Facets

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

739,718 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pSA293-CHEQ-seq
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_174669 Ampicillin PMID:34874265 Backbone Marker:Promega; Backbone Size:3730; Vector Backbone:pGL4.10; Vector Types:Enhancer reporter; Bacterial Resistance:Ampicillin 2026-08-01 01:08:39 1
pENTR/pTER shEGFP #1 (628-2)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_17470 Enhanced green fluorescent protein shRNA #1 Kanamycin PMID:19657394 shRNA oligo sequence 5'-CGAAGCAGCACGACTTCTTCTTCAAGAGAGAAGAAGTCGTGCTGCTTCTTTTT Backbone Marker:Invitrogen; Backbone Size:2555; Vector Backbone:pENTR1A; Vector Types:RNAi, Gateway Cloning; Bacterial Resistance:Kanamycin 2026-08-01 01:08:39 1
pE6n
 
Resource Report
Resource Website 		RRID:Addgene_17460 Kanamycin PMID:18211686 Part of a modified Gateway Entry vector system for generating epitope tagged constructs. Clone your gene of interest into this vector using the BamHI and NotI cloning sites to obtain a N-terminal EYFP tagged Entry vector. The resulting Entry vector can be recombined into Gateway Destination vectors for bacteria, insect mammalian, plant or yeast expression via the Gateway LR reaction. The tag is present in the Entry cassette to avoid the presence of att-derived protein linker sequences between the tag and gene or interest corresponding to the attB recombination site. A stop codon is already present within the vector (see plasmid map). GenBank accession number: EU344821 Backbone Marker:Invitrogen; Backbone Size:3030; Vector Backbone:pENTR1A; Vector Types:Mammalian Expression, Bacterial Expression, Yeast Expression, Insect Expression, Plant Expression, modified Gateway Entry vector; Bacterial Resistance:Kanamycin 2026-08-01 01:08:38 0
pE2c
 
Resource Report
Resource Website 		RRID:Addgene_17462 Kanamycin PMID:18211686 Part of a modified Gateway Entry vector system for generating epitope tagged constructs. Clone your gene of interest into this vector using the BamHI and NotI cloning sites to obtain a C-terminal 3x HA tagged Entry vector. The resulting Entry vector can be recombined into Gateway Destination vectors for bacteria, insect mammalian, plant or yeast expression via the Gateway LR reaction. The tag is present in the Entry cassette to avoid the presence of att-derived protein linker sequences between the tag and gene or interest corresponding to the attB recombination site. A stop codon is already present within the vector (see plasmid map). GenBank accession number: EU344823 Backbone Marker:Invitrogen; Backbone Size:2426; Vector Backbone:pENTR1A; Vector Types:Mammalian Expression, Bacterial Expression, Yeast Expression, Insect Expression, Plant Expression, modified Gateway Entry vector; Bacterial Resistance:Kanamycin 2026-08-01 01:08:38 0
pE4c
 
Resource Report
Resource Website 		RRID:Addgene_17464 Kanamycin PMID:18211686 Part of a modified Gateway Entry vector system for generating epitope tagged constructs. Clone your gene of interest into this vector using the BamHI and NotI cloning sites to obtain a C-terminal GST tagged Entry vector. The resulting Entry vector can be recombined into Gateway Destination vectors for bacteria, insect mammalian, plant or yeast expression via the Gateway LR reaction. The tag is present in the Entry cassette to avoid the presence of att-derived protein linker sequences between the tag and gene or interest corresponding to the attB recombination site. A stop codon is already present within the vector (see plasmid map). GenBank accession number: EU344826 Backbone Marker:Invitrogen; Backbone Size:2972; Vector Backbone:pENTR1A; Vector Types:Mammalian Expression, Bacterial Expression, Yeast Expression, Insect Expression, Plant Expression, modified Gateway Entry vector; Bacterial Resistance:Kanamycin 2026-08-01 01:08:38 0
pE5c
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_17465 Kanamycin PMID:18211686 Part of a modified Gateway Entry vector system for generating epitope tagged constructs. Clone your gene of interest into this vector using the BamHI and NotI cloning sites to obtain a C-terminal ECFP tagged Entry vector. The resulting Entry vector can be recombined into Gateway Destination vectors for bacteria, insect mammalian, plant or yeast expression via the Gateway LR reaction. The tag is present in the Entry cassette to avoid the presence of att-derived protein linker sequences between the tag and gene or interest corresponding to the attB recombination site. A stop codon is already present within the vector (see plasmid map). GenBank accession number: EU344826 Backbone Marker:Invitrogen; Backbone Size:3023; Vector Backbone:pENTR1A; Vector Types:Mammalian Expression, Bacterial Expression, Yeast Expression, Insect Expression, Plant Expression, modified Gateway Entry vector; Bacterial Resistance:Kanamycin 2026-08-01 01:08:38 1
pLV[Expression]-mCherry:T2A:Hygro-EF1A>Luc2
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_174665 LUC2 Synthetic Ampicillin Backbone Marker:VectorBuilder; Vector Backbone:pLV; Vector Types:Mammalian Expression, Lentiviral, Luciferase; Bacterial Resistance:Ampicillin 2026-08-01 01:08:39 3
Bnip3L RNAi pSuper-retro
 
Resource Report
Resource Website 		RRID:Addgene_17468 Bnip3L RNAi Homo sapiens Ampicillin PMID:15607964 Target sequence: AACAGTTCCTGGGTGGAGCTA Backbone Size:6349; Vector Backbone:pSuper-retro; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin 2026-08-01 01:08:39 0
pETSXM2-pLacI-mtrCAB
 
Resource Report
Resource Website 		RRID:Addgene_174618 mtrCAB Synthetic Kanamycin Please note MtrC starts at amino acid 75. Depositor confirms this is not a concern. Backbone Size:3903; Vector Backbone:pET-28a; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin 2026-08-01 01:08:38 0
Affibody HER2:243.BirA*-pET301/NT-DEST
 
Resource Report
Resource Website 		RRID:Addgene_174692 Anti-HER2 affibody ZHER2:342 fused to mutated form of BirA, BirA* Staphylococcus aureus and Escherichia coli Ampicillin PMID:36742360 Backbone Marker:Invitrogen; Backbone Size:7382; Vector Backbone:pET301/NT-DEST; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin R118G mutation in BirA 2026-08-01 01:08:39 0
PB713B-pCMV-MITD-NeoMini-T2A-tCD19-WPRE
 
Resource Report
Resource Website 		RRID:Addgene_174610 human CD19, antigen minigene Homo sapiens Ampicillin PMID:34396986 Vector Backbone:MP71; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-01 01:08:38 0
pMP71-mGFP-LLO-mPMEL
 
Resource Report
Resource Website 		RRID:Addgene_174608 membrane GFP fused to LLO and mouse PMEL antigen Ampicillin PMID:34396986 Vector Backbone:mp71; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-01 01:08:38 0
pMP71-IFN-gamma
 
Resource Report
Resource Website 		RRID:Addgene_174602 Constitutive expression of secreted murine IFN gamma Ampicillin PMID:34396986 Vector Backbone:mp71; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-01 01:08:38 0
pMP71-tCD19-llo-mc38tmg
 
Resource Report
Resource Website 		RRID:Addgene_174603 extracell transmem domains moCD19 wCterm fusion LLO190 and minigenes of 3neoantigens MC38tumor in genes ADGPK DPAGT Reps1 Ampicillin PMID:34396986 Vector Backbone:mp71; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-01 01:08:38 0
pMP71-mtGFP-llo-lama4-alg8
 
Resource Report
Resource Website 		RRID:Addgene_174605 palmytoylGFP w/C-term fusion LLO190 and minigenes of 2 neoantigens from the T3 tumor in genes Alg8 Lama4 Ampicillin PMID:34396986 Vector Backbone:mp71; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-01 01:08:38 0
6xHis-MBP-huPdCas12a
 
Resource Report
Resource Website 		RRID:Addgene_174682 huPdCas12a Prevotella disiens Kanamycin The vector is obtained from Scott Gradia Lab (Addgene #29656) while the gene is obtained from Feng Zhang Lab (Addgene #69990) . Read the preprint on medRxiv here: https://www.medrxiv.org/content/10.1101/2021.07.21.21260653v1 Backbone Marker:Scott Gradia Lab; Backbone Size:6462; Vector Backbone:pET; Vector Types:Bacterial Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Kanamycin 2026-08-01 01:08:39 0
6xHis-MBP-huErCas12a
 
Resource Report
Resource Website 		RRID:Addgene_174685 huErCas12a Eubacterium rectale Kanamycin The vector is obtained from Scott Gradia Lab (Addgene #29656) while the gene is obtained from Stephen Ekker Lab (Addgene #132641) . Read the preprint on medRxiv here: https://www.medrxiv.org/content/10.1101/2021.07.21.21260653v1 Backbone Marker:Scott Gradia Lab; Backbone Size:6462; Vector Backbone:pET; Vector Types:Bacterial Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Kanamycin Q926R mutation is observed as indicated from the lab the gene was obtained, but the mutation does not affect ErCas12a function 2026-08-01 01:08:39 0
6xHis-MBP-huPb2Cas12a
 
Resource Report
Resource Website 		RRID:Addgene_174686 huPb2Cas12a Prevotella bryantii B14 Kanamycin The vector is obtained from Scott Gradia Lab (Addgene #29656) while the gene is obtained from Feng Zhang Lab (Addgene #92272) . Read the preprint on medRxiv here: https://www.medrxiv.org/content/10.1101/2021.07.21.21260653v1 Backbone Marker:Scott Gradia Lab; Backbone Size:6462; Vector Backbone:pET; Vector Types:Bacterial Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Kanamycin 2026-08-01 01:08:39 0
6xHis-MBP-huTsCas12a
 
Resource Report
Resource Website 		RRID:Addgene_174687 huTsCas12a Thiomicrospira sp. XS5 Kanamycin The vector is obtained from Scott Gradia Lab (Addgene #29656) while the gene is obtained from Feng Zhang Lab (Addgene #92267) . Read the preprint on medRxiv here: https://www.medrxiv.org/content/10.1101/2021.07.21.21260653v1 Backbone Marker:Scott Gradia Lab; Backbone Size:6462; Vector Backbone:pET; Vector Types:Bacterial Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Kanamycin 2026-08-01 01:08:39 0
pB80-KIF1A(1-365)-VVDfast-mCherry-SSPB(micro)
 
Resource Report
Resource Website 		RRID:Addgene_174634 KIF1A(1-365)-VVDfast-mCherry-SSPB(micro) Mus musculus Ampicillin PMID:32328628 Internal plasmid ID: WN444 Vector Backbone:B-actin; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin mmKIF1A(aa1-365): Pro202Ala; ncVVD(aa37-184): Ile52Cys, Ile74Val, Ile85Val; mCherry: Met1Del; SSPB:Arg73Gln 2026-08-01 01:08:38 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. Kravitz Dataset 2 Resources

    Welcome to the kravitz2 Resources search. From here you can search through a compilation of resources used by kravitz2 and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that kravitz2 has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on kravitz2 then you can log in from here to get additional features in kravitz2 such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into kravitz2 you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Data set from Kravitz, Owen and Kretizer's 2012 paper "Optogenetic identification of striatal projection neuron subtypes during in vivo recordings."

Recent News Entries

Kravitz Dataset 2

Contact Us

E [email protected]

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch