Plasmids   Select Another Resource Report Type

http://www.addgene.org/50488

Species: Homo sapiens
Genetic Insert: TRF2
Vector Backbone Description: Backbone Marker:Life Technologies; Backbone Size:4378; Vector Backbone:pTrcHisB; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25115914
Comments: This set of TRF2 and TRF2 mutant vectors has been engineered reintroduce Alanine 434, which is deleted in most published TRF2 vectors, and to generate TRF2 and TRF2 mutant proteins with identical N-terminal tags.

Proper citation: RRID:Addgene_50488 Copy   

•   Source: Addgene

http://www.addgene.org/50520

Species: Homo sapiens
Genetic Insert: PTEN
Vector Backbone Description: Backbone Marker:Yamada Lab, Tamura et al., Science 280: 1614-7 (1998); Vector Backbone:pGZ21dxZ; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9616126

Proper citation: RRID:Addgene_50520 Copy   

•   Source: Addgene

http://www.addgene.org/50523

Species: Homo sapiens
Genetic Insert: PTEN
Vector Backbone Description: Backbone Marker:Yamada Lab, Tamura et al., Science 280: 1614-7 (1998); Vector Backbone:pGZ21dxZ; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9616126

Proper citation: RRID:Addgene_50523 Copy   

•   Source: Addgene

http://www.addgene.org/50529

Species: Homo sapiens
Genetic Insert: Paxillin
Vector Backbone Description: Backbone Marker:Yamada Lab, Tamura et al., Science 280: 1614-7 (1998); Vector Backbone:pGZ21dxZ; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_50529 Copy   

•   Source: Addgene

http://www.addgene.org/50495

Species: Homo sapiens
Genetic Insert: fibronectin
Vector Backbone Description: Vector Backbone:pVC70108; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:7929152
Comments: Primers used for amplification of insert: primer A (CCATATGGGTCGACCCAACTGG), which contains an NdeI site, methionine start codon, and 5' end of the 9th type III repeat sequence, and primer B (ATGAATTCTACATCTGGGATGGTTTGTCAA), which contains an EcoRI site, a stop codon, and the 3' end of the 37-kDa fibronectin fragment.

Proper citation: RRID:Addgene_50495 Copy   

•   Source: Addgene

http://www.addgene.org/50497

Species: Homo sapiens
Genetic Insert: NM_001306129.1
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pRSETC'; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:7545166

Proper citation: RRID:Addgene_50497 Copy   

•   Source: Addgene

http://www.addgene.org/50496

Species: Homo sapiens
Genetic Insert: fibronectin
Vector Backbone Description: Vector Backbone:pVC70108; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_50496 Copy   

•   Source: Addgene

http://www.addgene.org/50498

Species: Homo sapiens
Genetic Insert: fibronectin
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pRSETC'; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_50498 Copy   

•   Source: Addgene

http://www.addgene.org/50539

Species: Homo sapiens
Genetic Insert: PTEN
Vector Backbone Description: Backbone Marker:PMID 14729065; Vector Backbone:pRKVSV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_50539 Copy   

•   Source: Addgene

http://www.addgene.org/50547

Species: Other
Genetic Insert: MitoTimer
Vector Backbone Description: Backbone Marker:Clonetech; Backbone Size:2516; Vector Backbone:pTRE Tight; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24128932
Comments: The F12S mutation in Timer does not affect the function of the plasmid, as described in the associated publication. The Timer sequence is preceded by the mitochondrial targeting sequence from cytochrome c oxidase subunit 8A: MSVLTPLLLRGLTGSARRLPVPRAKIHSL

Proper citation: RRID:Addgene_50547 Copy   

•   Source: Addgene

http://www.addgene.org/50549

Species: Synthetic
Genetic Insert: mCherry
Vector Backbone Description: Backbone Marker:Registry of Standard Biological Parts; Backbone Size:3296; Vector Backbone:pSB4A3; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24608181
Comments: Note: Addgene's quality control sequencing found a few mismatches compared to the depositor's full sequence, but they should not affect plasmid function.

Proper citation: RRID:Addgene_50549 Copy   

•   Source: Addgene

http://www.addgene.org/50548

Species: Synechocystis sp. 6803
Genetic Insert: CcaS
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:1900; Vector Backbone:pProTet.E333; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:24608181
Comments: Note that Addgene NGS identified a nonsense mutation in the CcaS insert

Proper citation: RRID:Addgene_50548 Copy   

•   Source: Addgene

http://www.addgene.org/50552

Species: Synthetic
Genetic Insert: Cph8
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:1995; Vector Backbone:pProTet.E333; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:24608181
Comments: Encodes the Cph8 (Cph1/EnvZ fusion) light sensor kinase/phosphatase downstream of the pLTetO-1 promoter. Requires pPLPCB(S)t or some other source of TetR Requires PCB to function Does NOT include the response regulator.

Proper citation: RRID:Addgene_50552 Copy   

•   Source: Addgene

http://www.addgene.org/50551

Species: Synechocystis sp. 6803
Genetic Insert: CcaS
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:1900; Vector Backbone:pProTet.E333; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:24608181

Proper citation: RRID:Addgene_50551 Copy   

•   Source: Addgene

http://www.addgene.org/50554

Species: Drosophila melanogaster
Genetic Insert: Argonaute2
Vector Backbone Description: Backbone Marker:The Drosophila Gateway™ Vector Collection; Vector Backbone:pAFW; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20605501
Comments: Please note that when compared to GenBank reference sequence NP_648775.1, the Ago2 sequence in this plasmid is missing amino acids 49-54 (LQQPQQ).

Proper citation: RRID:Addgene_50554 Copy   

•   Source: Addgene

http://www.addgene.org/50556

Species: Synthetic
Genetic Insert: Luciferase-let7-Poly(A)
Vector Backbone Description: Backbone Marker:The Drosophila Gateway™ Vector Collection; Vector Backbone:pAHW; Vector Types:Insect Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23123195
Comments: This plasmid expresses a Renilla luciferase reporter for let-7 miRNA with a regular polyadenylation signal.

Proper citation: RRID:Addgene_50556 Copy   

•   Source: Addgene

http://www.addgene.org/50561

Species: Renilla, unknown
Genetic Insert: Luciferase-A114-N40
Vector Backbone Description: Backbone Marker:GeneScript; Backbone Size:2710; Vector Backbone:pUC57; Vector Types:cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22117217
Comments: Plasmid contains a defined A114 sequence followed by an EcoT22I site and a 40-bp arbitrary sequence downstream of Renilla lucferase. Unstable when transformed and so any retransformation must be checked by digest or sequencing before use. In strain MV1184, it is stable as a glycerol stock. Please note that the Rluc coding sequence contains an EcoT22I site. To prepare the T7 transcription template for A114 RNA (without N40), the plasmid should be first linearized by NdeI upstream of the T7 promoter sequence, followed by a partial digestion by EcoT22I. The DNA fragment terminating immediately downstream of the A114 sequence should then be gel purified. For A114-N40 RNA, the plasmid should be digested by HindIII downstream of the N40 sequence.

Proper citation: RRID:Addgene_50561 Copy   

•   Source: Addgene

http://www.addgene.org/50603

Genetic Insert: Limonene Synthase
Vector Backbone Description: Vector Backbone:E. coli DH10B; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23727191

Proper citation: RRID:Addgene_50603 Copy   

•   Source: Addgene

http://www.addgene.org/50685

Species: Other
Genetic Insert: LacZ + BsaI restriction sites
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pCR8; Vector Types:TALEN; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:24287550

Proper citation: RRID:Addgene_50685 Copy   

•   Source: Addgene

http://www.addgene.org/50606

Genetic Insert: tyrB
Vector Backbone Description: Vector Backbone:pRBS-01; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22020510

Proper citation: RRID:Addgene_50606 Copy   

•   Source: Addgene