Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Facets

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

739,718 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
FU-tet-o-hc-myc
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_19775 c-myc Homo sapiens Ampicillin PMID:18786420 From article, concerning viral infections: For a standard infection in a 35 mmdish (aprox 10^5 cells), 10 microL rtTA+5 microL factors (OCT4, SOX2, KLF4, and NANOG)+2 microL cMYC was used in an overnight infection supplemented with 6 microg/microL polybrene. Backbone Size:8400; Vector Backbone:FUdeltaGW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin T58A 2026-08-01 01:09:51 5
FU-tet-o-hKLF4
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_19777 Klf4 Homo sapiens Ampicillin PMID:18786420 From article, concerning viral infections: For a standard infection in a 35 mmdish (aprox 10^5 cells), 10 microL rtTA+5 microL factors (OCT4, SOX2, KLF4, and NANOG)+2 microL cMYC was used in an overnight infection supplemented with 6 microg/microL polybrene. Backbone Size:8400; Vector Backbone:FUdeltaGW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-01 01:09:51 4
pEGFP-U6-shR-E2-2
 
Resource Report
Resource Website 		RRID:Addgene_19810 shRNA Kanamycin PMID:18840295 Target sequence for shR-E2-2 - 5'-GCAATGCTGACGACTTTCAATGA Backbone Size:5000; Vector Backbone:pEGFP-U6; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Kanamycin 2026-08-01 01:09:52 0
FU-tet-o-hNanogP8
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_19776 NanogP8 Homo sapiens Ampicillin PMID:18786420 From article, concerning viral infections: For a standard infection in a 35 mmdish (aprox 10^5 cells), 10 microL rtTA+5 microL factors (OCT4, SOX2, KLF4, and NANOG)+2 microL cMYC was used in an overnight infection supplemented with 6 microg/microL polybrene. Backbone Size:8400; Vector Backbone:FUdeltaGW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-01 01:09:58 1
FU-tet-o-hSox2
 
Resource Report
Resource Website 		RRID:Addgene_19779 Sox2 Homo sapiens Ampicillin PMID:18786420 From article, concerning viral infections: For a standard infection in a 35 mmdish (aprox 10^5 cells), 10 microL rtTA+5 microL factors (OCT4, SOX2, KLF4, and NANOG)+2 microL cMYC was used in an overnight infection supplemented with 6 microg/microL polybrene. Backbone Size:8400; Vector Backbone:FUdeltaGW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-01 01:09:58 0
pEGFP-U6-shR-E2-4
 
Resource Report
Resource Website 		RRID:Addgene_19812 shRNA Kanamycin PMID:18840295 Target sequence for shR-E2-4 - 5'-GGAAGTGGTGTATAGAGATTATA Backbone Size:5000; Vector Backbone:pEGFP-U6; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Kanamycin 2026-08-01 01:09:52 0
pEGFP-U6-shR-E2-7
 
Resource Report
Resource Website 		RRID:Addgene_19814 shRNA Kanamycin PMID:18840295 Target sequence for shR-E2-7 - 5'-GAGGTTGACATGAGTAACATACA Backbone Size:5000; Vector Backbone:pEGFP-U6; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Kanamycin 2026-08-01 01:09:59 0
pEGFP-U6-shR-E2-5
 
Resource Report
Resource Website 		RRID:Addgene_19813 shRNA Kanamycin PMID:18840295 Target sequence for shR-E2-5 - 5'-GATATTGAACGGACCATTAATGA Backbone Size:5000; Vector Backbone:pEGFP-U6; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Kanamycin 2026-08-01 01:09:52 0
pCAG-EGFP/RFP-int
 
Resource Report
Resource Website 		RRID:Addgene_19818 empty vector Ampicillin PMID:18840295 The lacZ and the human placental alkaline phosphatase (AP) genes in the pZ/AP vector were replaced with EGFP, synthesized by PCR from pEGFP-N1 (Clontech), and RFP, synthesized by PCR from pDsRed2-C1 (Clontech), respectively. One cryptic start codon at the 5'UTR of the original AP gene that was not in frame was eliminated. These modifications produced a conditional vector for miRNA expression, pCAG-EGFP/RFP. A synthetic artificial intron was designed to contain typical intron splicing regulatory elements. This intron was placed 10 nt-downstream of the stop codon of the RFP gene to avoid NMD. Backbone Size:8200; Vector Backbone:pZ/AP; Vector Types:Mammalian Expression, RNAi, Cre/Lox; Bacterial Resistance:Ampicillin 2026-08-01 01:09:52 0
pCETT2
 
Resource Report
Resource Website 		RRID:Addgene_19784 Ampicillin PMID:18722998 Backbone Marker:Clontech; Backbone Size:8292; Vector Backbone:pGAD424; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-01 01:09:51 0
pCETF
 
Resource Report
Resource Website 		RRID:Addgene_19783 Ampicillin PMID:18778253 Backbone Marker:Clontech; Backbone Size:9033; Vector Backbone:pGAD424; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-01 01:09:58 0
pLenti CMV/TO V5-LUC Puro (w549-1)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_19785 Firefly Luciferase Ampicillin PMID:19657394 Backbone Size:8072; Vector Backbone:p156RRL-sinPPT-CMV-GFP-PRE/Nhe I; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-01 01:09:51 2
BacPAK Flag-NFRKB 1-465
 
Resource Report
Resource Website 		RRID:Addgene_19788 NFRKB Homo sapiens Ampicillin PMID:18922472 Backbone Marker:Clontech; Backbone Size:5400; Vector Backbone:BacPAK8; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin only contains amino acids 1-465 2026-08-01 01:09:51 0
pCAG-EGFP/RFP-miR-Scrint
 
Resource Report
Resource Website 		RRID:Addgene_19821 Scrambled miRNA Ampicillin PMID:18840295 A fragment of ~400 bases surrounding the miRNA insertion site was amplified from the first intron of the vector pUbC-miRNA-EGFP [36] with primers 5'-GCAATGACGCGATCGCTAATGCGGGAAAGCTCTTATTCGGGT-3' (forward) and 5'-AAGGCATGACGCGTTGTTGCGGCCGCCAGAGGTCCGGCGCCTGT-3' (reverse). miR-Scr: GGTACCTGCTGTTGACAGTGAGCGACGATGCTCTAATCGGTTCTATCAAGTGAAGCCACAGATGTTGATAGAACCTTAGAGCATCGCTGCCTACTGCCTCGGACTTCAAGGGGAATTC Backbone Size:8200; Vector Backbone:pCAG-EGFP/RFP-int; Vector Types:Mammalian Expression, RNAi, Cre/Lox; Bacterial Resistance:Ampicillin 2026-08-01 01:09:52 0
pET19b NFRKB 1-101
 
Resource Report
Resource Website 		RRID:Addgene_19787 NFRKB Homo sapiens Ampicillin PMID:18922472 Backbone Marker:Novagen; Backbone Size:5700; Vector Backbone:pET19b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin only contains amino acids 1-101 2026-08-01 01:09:58 0
pCAG-EGFP/RFP-miR-E2-4int
 
Resource Report
Resource Website 		RRID:Addgene_19820 miRNA Ampicillin PMID:18840295 A fragment of ~400 bases surrounding the miRNA insertion site was amplified from the first intron of the vector pUbC-miRNA-EGFP [36] with primers 5'-GCAATGACGCGATCGCTAATGCGGGAAAGCTCTTATTCGGGT-3' (forward) and 5'-AAGGCATGACGCGTTGTTGCGGCCGCCAGAGGTCCGGCGCCTGT-3' (reverse). miR-E2-4: GGTACCTGCTGTTGACAGTGAGCGAGAAGTGGTGTATCTAGAGATTATAGTGAAGCCACAGATGTATAATCTCTATACACCACTTCCTGCCTACTGCCTCGGACTTCAAGGGGAATTC Backbone Size:8200; Vector Backbone:pCAG-EGFP/RFP-int; Vector Types:Mammalian Expression, RNAi, Cre/Lox; Bacterial Resistance:Ampicillin 2026-08-01 01:09:52 0
pCAG-RFP-miR-Scrint
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_19825 Scrambled miRNA Ampicillin PMID:18840295 miR-Scr sequence: GGTACCTGCTGTTGACAGTGAGCGACGATGCTCTAATCGGTTCTATCAAGTGAAGCCACAGATGTTGATAGAACCTTAGAGCATCGCTGCCTACTGCCTCGGACTTCAAGGGGAATTC Backbone Size:6300; Vector Backbone:pCAG-RFP-int; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin 2026-08-01 01:09:59 4
pCAG-RFP-miR-E2-4int
 
Resource Report
Resource Website 		RRID:Addgene_19824 miRNA Ampicillin PMID:18840295 miR-E2-4 sequence: GGTACCTGCTGTTGACAGTGAGCGAGAAGTGGTGTATCTAGAGATTATAGTGAAGCCACAGATGTATAATCTCTATACACCACTTCCTGCCTACTGCCTCGGACTTCAAGGGGAATTC Backbone Size:6300; Vector Backbone:pCAG-RFP-int; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin 2026-08-01 01:09:52 0
pDESTmycQKI
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_19870 quaking homolog, KH domain RNA binding Homo sapiens Ampicillin PMID:18978028 Backbone Size:5862; Vector Backbone:pDESTmyc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-01 01:09:52 1
yfpsyndat
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_19991 yfpsynhdat Homo sapiens Ampicillin PMID:12065645 Backbone Marker:clontech; Backbone Size:6516; Vector Backbone:pcihygro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-01 01:09:53 1

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. Kravitz Dataset 2 Resources

    Welcome to the kravitz2 Resources search. From here you can search through a compilation of resources used by kravitz2 and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that kravitz2 has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on kravitz2 then you can log in from here to get additional features in kravitz2 such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into kravitz2 you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Data set from Kravitz, Owen and Kretizer's 2012 paper "Optogenetic identification of striatal projection neuron subtypes during in vivo recordings."

Recent News Entries

Kravitz Dataset 2

Contact Us

E [email protected]

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch