Plasmids   Select Another Resource Report Type

http://www.addgene.org/19669

Species: Caenorhabditis elegans
Genetic Insert: <*iA-1xNLS-mCherry::let-858(3’)
Vector Backbone Description: Backbone Size:0; Vector Backbone:pGC302; Vector Types:Worm Expression, FLP/FRT; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18723890

Proper citation: RRID:Addgene_19669 Copy   

•   Source: Addgene

http://www.addgene.org/19701

Species: Mus musculus
Genetic Insert: Merlin I
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pXJ40-HA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16247032

Proper citation: RRID:Addgene_19701 Copy   

•   Source: Addgene

http://www.addgene.org/19703

Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:6938; Vector Backbone:pCDNA5/FRT/TO; Vector Types:Mammalian Expression; Bacterial Resistance:Chloramphenicol and Ampicillin

Proper citation: RRID:Addgene_19703 Copy   

•   Source: Addgene

http://www.addgene.org/1977

Species: Mus musculus
Genetic Insert: RASSF1C
Vector Backbone Description: Backbone Size:4657; Vector Backbone:pCMV5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11857081

Proper citation: RRID:Addgene_1977 Copy   

•   Source: Addgene

http://www.addgene.org/19757

Species: Homo sapiens
Genetic Insert: Orai1
Vector Backbone Description: Backbone Size:0; Vector Backbone:EGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:16921383

Proper citation: RRID:Addgene_19757 Copy   

•   Source: Addgene

http://www.addgene.org/19758

Species: Homo sapiens
Genetic Insert: cyclin-dependent kinase 8
Vector Backbone Description: Backbone Size:5169; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18794900

Proper citation: RRID:Addgene_19758 Copy   

•   Source: Addgene

http://www.addgene.org/19809

Genetic Insert: shRNA
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pEGFP-U6; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18840295
Comments: Target sequence for shR-E2-1 - 5'-GTGCAATGCTGACGACTTTCAAT

Proper citation: RRID:Addgene_19809 Copy   

•   Source: Addgene

http://www.addgene.org/19808

Genetic Insert: shRNA
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pEGFP-U6; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18840295
Comments: Target sequence for shR-E1-8 - 5'-GCATCGTATATGAGACCTTCCAT

Proper citation: RRID:Addgene_19808 Copy   

•   Source: Addgene

http://www.addgene.org/19762

Species: Homo sapiens
Genetic Insert: small hairpin RNA against beta-catenin
Vector Backbone Description: Backbone Size:7032; Vector Backbone:pLKO.1 puro; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18794900
Comments: 2279 refers to the shRNA clone name from the RNAi Consortium at the Broad Institute and indicates the location on the CTNNB1 mRNA that is targeted. shRNA sequence for 2279 is: CCGGGCTTGGAATGAGACTGCTGATCTCGAGATCAGCAGTCTCATTCCAAGCTTTTT

Proper citation: RRID:Addgene_19762 Copy   

•   Source: Addgene

http://www.addgene.org/19764

Species: Mus musculus
Genetic Insert: Klf4
Vector Backbone Description: Backbone Size:9941; Vector Backbone:FUdeltaGW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18371448
Comments: From article: A tet-inducible lentivirus called LV-tetO was generated by removing the EcoRI/PacI fragment containing the ubiquitin promoter elements from the FUdeltaGW vector (modified from FUGW by removal of GFP with EcoRI-XbaI and re-creation of the EcoRI site) and replacing it with tetO sequences derived from pTet-Splice by EcoRI/XhoI digestion.cDNAs for c-Myc (T58A mutant), Klf4, Oct4, and Sox2 were isolated from pMIG or pMX vectors and cloned into LV-tetO using a unique EcoRI restriction site.

Proper citation: RRID:Addgene_19764 Copy   

•   Source: Addgene

http://www.addgene.org/19763

Species: Homo sapiens
Genetic Insert: c-myc
Vector Backbone Description: Backbone Size:9941; Vector Backbone:FUdeltaGW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18371448
Comments: From article: A tet-inducible lentivirus called LV-tetO was generated by removing the EcoRI/PacI fragment containing the ubiquitin promoter elements from the FUdeltaGW vector (modified from FUGW by removal of GFP with EcoRI-XbaI and re-creation of the EcoRI site) and replacing it with tetO sequences derived from pTet-Splice by EcoRI/XhoI digestion.cDNAs for c-Myc (T58A mutant), Klf4, Oct4, and Sox2 were isolated from pMIG or pMX vectors and cloned into LV-tetO using a unique EcoRI restriction site.

Proper citation: RRID:Addgene_19763 Copy   

•   Source: Addgene

http://www.addgene.org/19766

Species: Mus musculus
Genetic Insert: Oct4
Vector Backbone Description: Backbone Size:9941; Vector Backbone:FUdeltaGW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18371448
Comments: From article: A tet-inducible lentivirus called LV-tetO was generated by removing the EcoRI/PacI fragment containing the ubiquitin promoter elements from the FUdeltaGW vector (modified from FUGW by removal of GFP with EcoRI-XbaI and re-creation of the EcoRI site) and replacing it with tetO sequences derived from pTet-Splice by EcoRI/XhoI digestion.cDNAs for c-Myc (T58A mutant), Klf4, Oct4, and Sox2 were isolated from pMIG or pMX vectors and cloned into LV-tetO using a unique EcoRI restriction site. Note that the region immediately upstream of the insert in the author's sequence is not 100% accurate. See Addgene's quality control sequence for this region.

Proper citation: RRID:Addgene_19766 Copy   

•   Source: Addgene

http://www.addgene.org/19765

Species: Mus musculus
Genetic Insert: Sox2
Vector Backbone Description: Backbone Size:9941; Vector Backbone:FUdeltaGW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18371448
Comments: From article: A tet-inducible lentivirus called LV-tetO was generated by removing the EcoRI/PacI fragment containing the ubiquitin promoter elements from the FUdeltaGW vector (modified from FUGW by removal of GFP with EcoRI-XbaI and re-creation of the EcoRI site) and replacing it with tetO sequences derived from pTet-Splice by EcoRI/XhoI digestion.cDNAs for c-Myc (T58A mutant), Klf4, Oct4, and Sox2 were isolated from pMIG or pMX vectors and cloned into LV-tetO using a unique EcoRI restriction site.

Proper citation: RRID:Addgene_19765 Copy   

•   Source: Addgene

http://www.addgene.org/19800

Genetic Insert: scrambled shRNA
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pEGFP-U6; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18840295
Comments: The scrambled sequence for shR-Scr - 5'-GCGATGCTCTAAGGTTCTATCAA

Proper citation: RRID:Addgene_19800 Copy   

•   Source: Addgene

http://www.addgene.org/19805

Genetic Insert: shRNA
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pEGFP-U6; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18840295
Comments: Target sequence for shR-E1-5 - 5'-GATGATGCTCCGGTAACTGTTTC

Proper citation: RRID:Addgene_19805 Copy   

•   Source: Addgene

http://www.addgene.org/19804

Genetic Insert: shRNA
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pEGFP-U6; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18840295
Comments: Target sequence for shR-E1-4 - 5'-GCACAACCTAACGTCGACAAACT

Proper citation: RRID:Addgene_19804 Copy   

•   Source: Addgene

http://www.addgene.org/19807

Genetic Insert: shRNA
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pEGFP-U6; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18840295
Comments: Target sequence for shR-E1-7 - 5'-GCAATTAGGACGTTTCAACAGAT

Proper citation: RRID:Addgene_19807 Copy   

•   Source: Addgene

http://www.addgene.org/19806

Genetic Insert: shRNA
Vector Backbone Description: Backbone Size:5000; Vector Backbone:pEGFP-U6; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18840295
Comments: Target sequence for shR-E1-6 - 5'-GATCTGGTGTGTTATCGACGAAA

Proper citation: RRID:Addgene_19806 Copy   

•   Source: Addgene

http://www.addgene.org/19852

Species: Homo sapiens
Genetic Insert: MKL1
Vector Backbone Description: Backbone Marker:Sigma; Backbone Size:4700; Vector Backbone:pCMV-3xFLAG-7.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18694962
Comments: The 3xFlag in the vector is from Sigma, p3xFlag-CMV-7.1 has variant flag sequences (DYKDHD) and is recognized well by their anti-flag monoclonal M2.

Proper citation: RRID:Addgene_19852 Copy   

•   Source: Addgene

http://www.addgene.org/19858

Species: Homo sapiens
Genetic Insert: RHEBL1 3'UTR
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:6249; Vector Backbone:psiCHECK-2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18978028
Comments: There are small differences between author's sequence and Addgene sequence. Depositor is aware of the changes. These changes in the sequence do not affect the function of the construct.

Proper citation: RRID:Addgene_19858 Copy   

•   Source: Addgene