Plasmids   Select Another Resource Report Type

http://www.addgene.org/159427

Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4682; Vector Backbone:pFastBac1; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33971243
Comments: - This vector is designed to avoid adding non-native amino acid residues to the protein of interest, following TEV protease cleavage of the N-terminal purification tag. Subcloning requires ligation-independent cloning and use of the two BseRI restriction sites that are present in this empty vector. The two BseRI sites span a removable 432 nucleotide sequence. Cloning into the BseRI-digested vector can be achieved using a ligation-independent system that is dependent on homologous recombination, such as the Takara In-Fusion HD Cloning Plus system, which requires simply designing the PCR-derived insert (containing the protein of interest) to contain 15 bp at each end that matches the 15 bp at each end of the linearized parent vector. In other words, add these 15 bp, AACCTCTACTTCCAA, to the 5' end of the PCR FORWARD primer, and add these 15 bp, AGTACTTCTCGACAA, to the 5' end of the PCR REVERSE primer. - The sequence of the N-terminus will be MGSS + His10 + ENLYFQ*X, where * is the TEV protease cleavage site and X is the N-terminus of the protein of interest. Note that TEV protease cleaves most efficiently when X = S, G, A, M; for other compatible residues see Kapust et al 2002, PMID 12074568. - BseRI cuts 8-10 nucleotides outside of its own recognition sequence and is a non-palindromic site. The placement & orientation of the two BseRI sites eliminates all of the BseRI recognition sequence in the resulting subclone. - An unwanted BseRI site was removed from the parent pFastBac1 vector by introducing a silent mutation (CTC to CTG) in a leucine codon in the gentamicin-resistance gene. - To identify colonies containing a cloned insert, used the primers PFASTBAC1F (CTAGTGGTTGGCTACGTATACTCCG) and PFASTBAC1R (GGACAAACCACAACTAGAATGCAGTG). - To verify the PCR-generated insert sequence, use sequencing primers POLYHEDF (AAATGATAACCATCTCGC), SV40PAR (GAAATTTGTGATGCTATTGC). - To verify Tn7-based incorporation of the expression construct into the bacmid DNA in the E. coli strain DH10Bac, use PCR primers BACM13F (CCCAGTCACGACGTTGTAAAACG) and BACM13R (AGCGGATAACAATTTCACACAGG). A bacmid containing the correct insert has a PCR product size of ~2300 base pairs plus the length of the added insert.

Proper citation: RRID:Addgene_159427 Copy   

•   Source: Addgene

http://www.addgene.org/159428

Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4682; Vector Backbone:pFastBac1; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Comments: - This vector is designed to avoid adding non-native amino acid residues to the protein of interest, following TEV protease cleavage of the N-terminal purification tags. Subcloning requires ligation-independent cloning and use of the two BseRI restriction sites that are present in this empty vector. The two BseRI sites span a removable 432 nucleotide sequence. Cloning into the BseRI-digested vector can be achieved using a ligation-independent system that is dependent on homologous recombination, such as the Takara In-Fusion HD Cloning Plus system, which requires simply designing the PCR-derived insert (containing the protein of interest) to contain 15 bp at each end that matches the 15 bp at each end of the linearized parent vector. In other words, add these 15 bp, AACCTCTACTTCCAA, to the 5' end of the PCR FORWARD primer, and add these 15 bp, AGTACTTCTCGACAA, to the 5' end of the PCR REVERSE primer. - The sequence of the N-terminus will be MKFLVNVALVFMVVYISYIYA + AAPE + HHHHHHHHHH + GAP + ENLYFQ*X, where * is the TEV protease cleavage site and X is the N-terminus of the protein of interest. Note that TEV protease cleaves most efficiently when X = S, G, A, M; for other compatible residues see Kapust et al 2002, PMID 12074568. - The first 21 residues of the N-terminus (MKFLVNVALVFMVVYISYIYA) is the melittin signal peptide, which directs the protein to the endoplasmic reticulum for potential secretion. These 21 residues are expected to be removed by the cell’s signal peptidase. - BseRI cuts 8-10 nucleotides outside of its own recognition sequence and is a non-palindromic site. The placement & orientation of the two BseRI sites eliminates all of the BseRI recognition sequence in the resulting subclone. - An unwanted BseRI site was removed from the parent pFastBac1 vector by introducing a silent mutation (CTC to CTG) in a leucine codon in the gentamicin-resistance gene. - To identify colonies containing a cloned insert, used the primers PFASTBAC1F (CTAGTGGTTGGCTACGTATACTCCG) and PFASTBAC1R (GGACAAACCACAACTAGAATGCAGTG). - To verify the PCR-generated insert sequence, use sequencing primers POLYHEDF (AAATGATAACCATCTCGC), SV40PAR (GAAATTTGTGATGCTATTGC). - To verify Tn7-based incorporation of the expression construct into the bacmid DNA in the E. coli strain DH10Bac, use PCR primers BACM13F (CCCAGTCACGACGTTGTAAAACG) and BACM13R (AGCGGATAACAATTTCACACAGG). A bacmid containing the correct insert has a PCR product size of ~2300 base pairs plus the length of the added insert.

Proper citation: RRID:Addgene_159428 Copy   

•   Source: Addgene

http://www.addgene.org/159423

Species: Synthetic
Genetic Insert: Sb68
Vector Backbone Description: Vector Backbone:pSB_init; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:33303987
Comments: Full sequence is provided but the depositors have only verified the sequence of the multi-cloning site and the TGP-encoding region by DNA sequencing.

Proper citation: RRID:Addgene_159423 Copy   

•   Source: Addgene

http://www.addgene.org/159420

Species: Synthetic
Genetic Insert: thermostable GFP (TGP)
Vector Backbone Description: Vector Backbone:pBacMam; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33303987
Comments: Full sequence is provided but the depositors have only verified the sequence of the multi-cloning site and the TGP-encoding region by DNA sequencing.

Proper citation: RRID:Addgene_159420 Copy   

•   Source: Addgene

http://www.addgene.org/15955

Species: Mus musculus
Genetic Insert: M12
Vector Backbone Description: Backbone Size:3000; Vector Backbone:pBSIISK-; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17662950
Comments: to make RNA probe, cut with NotI. Then do in vitro transcription with T7RNA polymerase.

Proper citation: RRID:Addgene_15955 Copy   

•   Source: Addgene

http://www.addgene.org/159557

Species: Homo sapiens
Genetic Insert: His6-MBP-tev-G-Hs.KRAS4b(1-188) G13D
Vector Backbone Description: Vector Backbone:pDest-636; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26522388

Proper citation: RRID:Addgene_159557 Copy   

•   Source: Addgene

http://www.addgene.org/159556

Species: Homo sapiens
Genetic Insert: His6-MBP-tev-G-Hs.KRAS4b(1-188) G12V
Vector Backbone Description: Vector Backbone:pDest-636; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26522388

Proper citation: RRID:Addgene_159556 Copy   

•   Source: Addgene

http://www.addgene.org/159553

Species: Homo sapiens
Genetic Insert: His6-MBP-tev-G-Hs.KRAS4b(1-188)
Vector Backbone Description: Vector Backbone:pDest-636; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26522388

Proper citation: RRID:Addgene_159553 Copy   

•   Source: Addgene

http://www.addgene.org/159554

Species: Homo sapiens
Genetic Insert: His6-MBP-tev-G-Hs.KRAS4b(1-188) G12C
Vector Backbone Description: Vector Backbone:pDest-636; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26522388

Proper citation: RRID:Addgene_159554 Copy   

•   Source: Addgene

http://www.addgene.org/15959

Species: E. coli
Genetic Insert: Escherichia coli surA delta PPIase domain 2
Vector Backbone Description: Backbone Marker:New England Biolabs; Backbone Size:7280; Vector Backbone:pTYB1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17825319

Proper citation: RRID:Addgene_15959 Copy   

•   Source: Addgene

http://www.addgene.org/15958

Species: E. coli
Genetic Insert: Escherichia coli surA delta PPIase domain 2
Vector Backbone Description: Backbone Marker:New England Biolabs; Backbone Size:7280; Vector Backbone:pTYB1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17825319

Proper citation: RRID:Addgene_15958 Copy   

•   Source: Addgene

http://www.addgene.org/159605

Species: Synthetic
Genetic Insert: NIR-GECO2G
Vector Backbone Description: Backbone Size:4732; Vector Backbone:pAAV-CAG; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33232322
Comments: Please visit https://www.biorxiv.org/content/10.1101/2020.04.08.032433v2 for bioRxiv preprint.

Proper citation: RRID:Addgene_159605 Copy   

•   Source: Addgene

http://www.addgene.org/159606

Species: Synthetic
Genetic Insert: wNIR-GECO2-T2A-HO1
Vector Backbone Description: Backbone Size:6090; Vector Backbone:pSF11; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33232322
Comments: Please visit https://www.biorxiv.org/content/10.1101/2020.04.08.032433v2 for bioRxiv preprint.

Proper citation: RRID:Addgene_159606 Copy   

•   Source: Addgene

http://www.addgene.org/159568

Species: Homo sapiens
Genetic Insert: His6-MBP-tev-Avi-Hs.KRAS4b(2-188) G12C
Vector Backbone Description: Vector Backbone:pDest-566; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26522388

Proper citation: RRID:Addgene_159568 Copy   

•   Source: Addgene

http://www.addgene.org/159569

Species: Homo sapiens
Genetic Insert: His6-MBP-tev-Avi-Hs.KRAS4b(2-188) G12D
Vector Backbone Description: Vector Backbone:pDest-566; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26522388

Proper citation: RRID:Addgene_159569 Copy   

•   Source: Addgene

http://www.addgene.org/159600

Species: Synthetic
Genetic Insert: DD-DamV133A-IRES2-mCherry
Vector Backbone Description: Backbone Size:3800; Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:33099405
Comments: dam-/dcm- strain should be used for downstream applications

Proper citation: RRID:Addgene_159600 Copy   

•   Source: Addgene

http://www.addgene.org/159564

Species: Homo sapiens
Genetic Insert: His6-MBP-tev-Avi-Hs.KRAS4b(2-169) G13D
Vector Backbone Description: Vector Backbone:pDest-566; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26522388

Proper citation: RRID:Addgene_159564 Copy   

•   Source: Addgene

http://www.addgene.org/159565

Species: Homo sapiens
Genetic Insert: His6-MBP-tev-Avi-Hs.KRAS4b(2-169) Q61L
Vector Backbone Description: Vector Backbone:pDest-566; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26522388

Proper citation: RRID:Addgene_159565 Copy   

•   Source: Addgene

http://www.addgene.org/159562

Species: Homo sapiens
Genetic Insert: His6-MBP-tev-Avi-Hs.KRAS4b(2-169) G12D
Vector Backbone Description: Vector Backbone:pDest-566; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26522388

Proper citation: RRID:Addgene_159562 Copy   

•   Source: Addgene

http://www.addgene.org/159563

Species: Homo sapiens
Genetic Insert: His6-MBP-tev-Avi-Hs.KRAS4b(2-169) G12V
Vector Backbone Description: Vector Backbone:pDest-566; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26522388

Proper citation: RRID:Addgene_159563 Copy   

•   Source: Addgene