Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Vector Backbone Description: Backbone Marker:Herbert Schweizer; Vector Backbone:pUC18-mini-Tn7T-Gm; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol and Gentamicin
Defining Citation: PMID:15908923
Comments: GenBank Accession # AY737004
Proper citation: RRID:Addgene_64961 Copy
Species: Staphylococcus aureus ATCC 10832
Genetic Insert: sortase A
Vector Backbone Description: Backbone Marker:New England Biolabs; Backbone Size:6688; Vector Backbone:pTWIN1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22729808
Proper citation: RRID:Addgene_64973 Copy
Species: Homo sapiens
Genetic Insert: syndecan 2
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24662262
Comments: Cloning by PCR using oligo (ccactgcttactggcatgcggcgcgcgtggatc) that links the 3' region of CMV promoter of pCDNA3 to the SDC2 signal peptide and the oligo (ctagaaggcacagtcgcagtgatctcataaaatagagacac) that links the polyadenilation site of bovine growth hormone in pcDNA3 to the 3'UTR of SDC2 (FAAF).
Proper citation: RRID:Addgene_64972 Copy
Vector Backbone Description: Backbone Size:3000; Vector Backbone:ColE (from pZ system) + AmpR; Vector Types:Bacterial Expression, Synthetic Biology, E. coli; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25982507
Proper citation: RRID:Addgene_64909 Copy
Vector Backbone Description: Backbone Size:3500; Vector Backbone:ColE (from pZ system) + KanR; Vector Types:Bacterial Expression, Synthetic Biology, E. coli; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25982507
Proper citation: RRID:Addgene_64906 Copy
Vector Backbone Description: Backbone Size:3000; Vector Backbone:ColE (from pZ system) + KanR; Vector Types:Bacterial Expression, Synthetic Biology, E. coli; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25982507
Proper citation: RRID:Addgene_64905 Copy
Vector Backbone Description: Backbone Size:3500; Vector Backbone:ColE (from pZ system) + KanR; Vector Types:Bacterial Expression, Synthetic Biology, E. coli; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25982507
Proper citation: RRID:Addgene_64908 Copy
Species: Staphylococcus aureus ATCC 10832
Genetic Insert: sortase A
Vector Backbone Description: Backbone Marker:New England Biolabs; Backbone Size:6688; Vector Backbone:pTWIN1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22729808
Proper citation: RRID:Addgene_64981 Copy
Species: Staphylococcus aureus ATCC 10832
Genetic Insert: sortase A
Vector Backbone Description: Backbone Marker:IBA; Backbone Size:3211; Vector Backbone:pASK-IBA3 plus; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:25864513
Proper citation: RRID:Addgene_64983 Copy
Species: Staphylococcus aureus ATCC 10832
Genetic Insert: sortase A
Vector Backbone Description: Backbone Marker:New England Biolabs; Backbone Size:6688; Vector Backbone:pTWIN1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22729808
Proper citation: RRID:Addgene_64980 Copy
Species: Synthetic
Genetic Insert: pnGFP
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5968; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24059533
Comments: Please cite Z. Chen, W. Ren, Q.E. Wright and H-w. Ai*, J. Am. Chem. Soc., 2013, 135: 14940-14943.
Proper citation: RRID:Addgene_64913 Copy
Species: Rattus norvegicus
Genetic Insert: Transient receptor potential cation channel subfamily M member 8
Vector Backbone Description: Backbone Size:4727; Vector Backbone:pEGFP_C3; Vector Types:; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25589752
Proper citation: RRID:Addgene_64879 Copy
Species: Synthetic
Genetic Insert: hsGFP
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5968; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25141269
Comments: Please cite Z. Chen and H-w. Ai*, Biochemistry, 2014, 53: 5966-5974; and S. Chen, Z. Chen, W. Ren and H-w. Ai*, J. Am. Chem. Soc., 2012, 134: 9589-9592. Please note that you will also need a pMAH plasmid for mammalian expression. pMAH-POLY (Z. Chen, W. Ren, Q.E. Wright and H-w. Ai*, J. Am. Chem. Soc., 2013, 135: 14940-14943.) is also deposited to Addgene, which can be used to replace pMAH-AzF for mammalian applications.
Proper citation: RRID:Addgene_64912 Copy
Species: Synthetic
Genetic Insert: hsGFP
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3954; Vector Backbone:pBAD/HisB; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25141269
Comments: Please cite: Z. Chen and H-w. Ai*, Biochemistry, 2014, 53: 5966-5974; and S. Chen, Z. Chen, W. Ren and H-w. Ai*, J. Am. Chem. Soc., 2012, 134: 9589-9592. For E. coli expression, you will also need pEVOL-pAzF (Addgene # 31186): https://www.addgene.org/31186/
Proper citation: RRID:Addgene_64911 Copy
Species: Homo sapiens
Genetic Insert: Glutaredoxin-1
Vector Backbone Description: Vector Backbone:pCaSpeR4; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22100409
Comments: Sequence discrepancies found during QC should not affect function
Proper citation: RRID:Addgene_64999 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Orp1
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pLPCX; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19755417
Proper citation: RRID:Addgene_64992 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Orp1
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pLPCX; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19755417
Proper citation: RRID:Addgene_64991 Copy
Species: Homo sapiens
Genetic Insert: Glutaredoxin-1
Vector Backbone Description: Vector Backbone:pEIGW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18469822
Comments: Sequence discrepancies found during QC should not affect function
Proper citation: RRID:Addgene_64990 Copy
Species: Homo sapiens
Genetic Insert: hnRNPM
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4219; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_64924 Copy
Species: Rhodopseudomonas palustris
Genetic Insert: iRFP
Vector Backbone Description: Backbone Marker:Cell Biolabs; Vector Backbone:pAAV-CMV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25391913
Proper citation: RRID:Addgene_64887 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the kravitz2 Resources search. From here you can search through a compilation of resources used by kravitz2 and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that kravitz2 has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on kravitz2 then you can log in from here to get additional features in kravitz2 such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into kravitz2 you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within kravitz2 that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Data set from Kravitz, Owen and Kretizer's 2012 paper "Optogenetic identification of striatal projection neuron subtypes during in vivo recordings."
