Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Facets

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

739,423 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pMTS-hFluc
 
Resource Report
Resource Website 		RRID:Addgene_177716 hFluc Other Ampicillin PMID:34857875 Vector Backbone:phFluc-WT; Vector Types:Mammalian Expression, Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-01 01:09:10 0
pPLN-hFluc-WT-KDEL
 
Resource Report
Resource Website 		RRID:Addgene_177715 hFluc Other Ampicillin PMID:34857875 Backbone Marker:Addgene #177714; Vector Backbone:phFluc-WT; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-01 01:09:10 0
pATZ-Myc
 
Resource Report
Resource Website 		RRID:Addgene_177718 alpha-1-antitrypsin Homo sapiens Ampicillin PMID:34857875 Backbone Marker:Addgene #177714; Vector Backbone:phFluc-WT; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Ampicillin E342K (ATZ mutant) 2026-08-01 01:09:10 0
pAT-WT-HA-GFP11
 
Resource Report
Resource Website 		RRID:Addgene_177719 alpha-1-antitrypsin Homo sapiens Ampicillin PMID:34857875 Backbone Marker:Addgene #177714; Vector Backbone:phFluc-WT; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-01 01:09:10 0
pAAV-nEF-Con/Foff DREADD Gi-mCherry
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_177673 DREADD Gi-mCherry Synthetic Ampicillin Backbone Marker:Stratagene; Backbone Size:4591; Vector Backbone:pAAV; Vector Types:Mammalian Expression, Mouse Targeting, AAV, Cre/Lox, INTRSECT; Bacterial Resistance:Ampicillin 2026-08-01 01:09:09 1
Grin1 gRNA#1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_169789 Grin1 Mus musculus Ampicillin PMID:34161760 Vector Backbone:gRNA backbone; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin 2026-08-01 01:07:57 1
pGRNA5e
 
Resource Report
Resource Website 		RRID:Addgene_169786 Kanamycin PMID:32190101 Backbone Marker:BIOFACT; Vector Backbone:All in One™ vector; Vector Types:Unspecified; Bacterial Resistance:Kanamycin 2026-08-01 01:07:57 0
XP17 Xwnt-5A
 
Resource Report
Resource Website 		RRID:Addgene_16985 Xwnt-5A Xenopus laevis Ampicillin PMID:8275867 Insert: cDNA from Melton lambda gt10 oocyte library. Transcription: linearize with Xba1 and transcribe with SP6. Plasmid History: Constructed by Randall Moon on date of 9/15/90. Notes for Use: EcoR1 insert of lambda G6 of 2/11/90. Contains significant 5' UTR and is less translatable in vitro per ng RNA than Xwnt-5A Hind III/SP64T. However, the type of activity is the same in both constructs. Citation: Moon et al., Development 119, 97 (1993) Backbone Size:3000; Vector Backbone:pSP64T; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-01 01:07:57 0
XP6 Banded hh
 
Resource Report
Resource Website 		RRID:Addgene_16984 banded hedgehog Xenopus laevis Ampicillin Xenopus Hedgehog. Antisense are generated as listed: Xenopus banded hedgehog: Linearize clone XIL in Bluescript KS with BamH1 and transcribe with T3. This is a ~2.5 Kb EcoR1 insert. Xenopus sonic hedgehog: Linearize clone X32 in Bluescript KS with Bam H1 and transcribe with T3. This is a ~2.5 Kb EcoR1 insert. Xenopus cephalic hedgehog:Linearize clone X30 in pT7TS with Sal 1 and transcribe with T7. Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBluescript KS; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-01 01:07:57 0
pGRNA4
 
Resource Report
Resource Website 		RRID:Addgene_169781 Kanamycin PMID:32190101 Backbone Marker:BIOFACT; Vector Backbone:All in One™ vector; Vector Types:Unspecified; Bacterial Resistance:Kanamycin 2026-08-01 01:07:57 0
pGRNA2e
 
Resource Report
Resource Website 		RRID:Addgene_169782 Kanamycin PMID:32190101 Backbone Marker:BIOFACT; Vector Backbone:All in One™ vector; Vector Types:Unspecified; Bacterial Resistance:Kanamycin 2026-08-01 01:07:57 0
pGRNA3
 
Resource Report
Resource Website 		RRID:Addgene_169780 Kanamycin PMID:32190101 Backbone Marker:BIOFACT; Vector Backbone:All in One™ vector; Vector Types:Unspecified; Bacterial Resistance:Kanamycin 2026-08-01 01:07:57 0
pGRNA2
 
Resource Report
Resource Website 		RRID:Addgene_169779 Kanamycin PMID:32190101 Backbone Marker:BIOFACT; Vector Backbone:All in One™ vector; Vector Types:Unspecified; Bacterial Resistance:Kanamycin 2026-08-01 01:07:57 0
p15LZ
 
Resource Report
Resource Website 		RRID:Addgene_169814 Chloramphenicol PMID:34086276 Vector Backbone:p15A; Vector Types:; Bacterial Resistance:Chloramphenicol 2026-08-01 01:07:57 0
pEPIC1.1
 
Resource Report
Resource Website 		RRID:Addgene_169897 Ampicillin PMID:32917762 Backbone Size:4663; Vector Backbone:pEPIC1.1; Vector Types:Mammalian Expression, Avian expression; Bacterial Resistance:Ampicillin 2026-08-01 01:07:57 0
pPID2
 
Resource Report
Resource Website 		RRID:Addgene_169898 Ampicillin PMID:32917762 Backbone Size:2427; Vector Backbone:pPID2; Vector Types:Cloning Vector; Bacterial Resistance:Ampicillin 2026-08-01 01:07:57 0
pSin4 UAP1 F383G
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_169891 UDP-N-acetylhexosamine pyrophosphorylase Homo sapiens Ampicillin PMID:34288588 This plasmid was generated in the lab a long time ago and we cannot locate detailed cloning information at this point. Backbone Size:7500; Vector Backbone:pSin4 EF1a IRES Puro; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin Changed Phenylalanine (F) at position 383 to glycine (G) 2026-08-01 01:07:57 1
pLentiCRISPR V2 sgACO1_2
 
Resource Report
Resource Website 		RRID:Addgene_169892 sgRNA targeting ACO1 Synthetic Ampicillin PMID:34039609 Target: CCACTACCCCAACCTGGCGG Backbone Marker:Broad Institute; Backbone Size:11590; Vector Backbone:pLENTICRISPR V2; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin 2026-08-01 01:07:57 0
XE238 hVangl2/Strabismus pCS2P+
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_16992 Vangl2/Strabismus Homo sapiens Ampicillin This is a wild type human VANGL2/Strabismuus, cloned into pCS2P+. Injected RNA in zebrafish embryos gives the expected convergent/extension phenotype (Chris Thorpe, unpub. observations). Reference: Made by Yan Zhang by PCR for RTM. Cloned as a Cla1-Xho1 insert. Backbone Size:4100; Vector Backbone:pCS2P+; Vector Types:Xenopus Expression; Bacterial Resistance:Ampicillin 2026-08-01 01:07:58 1
pLentiCRISPR V2 sgIREB2_1
 
Resource Report
Resource Website 		RRID:Addgene_169894 sgRNA targeting IREB2 Synthetic Ampicillin PMID:34039609 Target: AATGCACCAAATCCTGGAGG Backbone Marker:Broad Institute; Backbone Size:11590; Vector Backbone:pLENTICRISPR V2; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin 2026-08-01 01:07:57 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. Kravitz Dataset 2 Resources

    Welcome to the kravitz2 Resources search. From here you can search through a compilation of resources used by kravitz2 and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that kravitz2 has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on kravitz2 then you can log in from here to get additional features in kravitz2 such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into kravitz2 you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Data set from Kravitz, Owen and Kretizer's 2012 paper "Optogenetic identification of striatal projection neuron subtypes during in vivo recordings."

Recent News Entries

Kravitz Dataset 2

Contact Us

E [email protected]

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch