Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Other
Genetic Insert: hFluc
Vector Backbone Description: Vector Backbone:phFluc-WT; Vector Types:Mammalian Expression, Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_177716 Copy
Species: Other
Genetic Insert: hFluc
Vector Backbone Description: Backbone Marker:Addgene #177714; Vector Backbone:phFluc-WT; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_177715 Copy
Species: Homo sapiens
Genetic Insert: alpha-1-antitrypsin
Vector Backbone Description: Backbone Marker:Addgene #177714; Vector Backbone:phFluc-WT; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_177718 Copy
Species: Homo sapiens
Genetic Insert: alpha-1-antitrypsin
Vector Backbone Description: Backbone Marker:Addgene #177714; Vector Backbone:phFluc-WT; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_177719 Copy
Species: Synthetic
Genetic Insert: DREADD Gi-mCherry
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4591; Vector Backbone:pAAV; Vector Types:Mammalian Expression, Mouse Targeting, AAV, Cre/Lox, INTRSECT; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_177673 Copy
Species: Mus musculus
Genetic Insert: Grin1
Vector Backbone Description: Vector Backbone:gRNA backbone; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_169789 Copy
Species:
Genetic Insert:
Vector Backbone Description: Backbone Marker:BIOFACT; Vector Backbone:All in One™ vector; Vector Types:Unspecified; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_169786 Copy
Species: Xenopus laevis
Genetic Insert: Xwnt-5A
Vector Backbone Description: Backbone Size:3000; Vector Backbone:pSP64T; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments: Insert: cDNA from Melton lambda gt10 oocyte library.
Transcription: linearize with Xba1 and transcribe with SP6.
Plasmid History:
Constructed by Randall Moon on date of 9/15/90.
Notes for Use:
EcoR1 insert of lambda G6 of 2/11/90. Contains significant 5' UTR and is less translatable in vitro per ng RNA than Xwnt-5A Hind III/SP64T. However, the type of activity is the same in both constructs.
Citation: Moon et al., Development 119, 97 (1993)
Proper citation: RRID:Addgene_16985 Copy
Species: Xenopus laevis
Genetic Insert: banded hedgehog
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBluescript KS; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments: Xenopus Hedgehog. Antisense are generated as listed:
Xenopus banded hedgehog: Linearize clone XIL in Bluescript KS with BamH1 and transcribe with T3. This is a ~2.5 Kb EcoR1 insert.
Xenopus sonic hedgehog: Linearize clone X32 in Bluescript KS with Bam H1 and transcribe with T3. This is a ~2.5 Kb EcoR1 insert.
Xenopus cephalic hedgehog:Linearize clone X30 in pT7TS with Sal 1 and transcribe with T7.
Proper citation: RRID:Addgene_16984 Copy
Species:
Genetic Insert:
Vector Backbone Description: Backbone Marker:BIOFACT; Vector Backbone:All in One™ vector; Vector Types:Unspecified; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_169781 Copy
Species:
Genetic Insert:
Vector Backbone Description: Backbone Marker:BIOFACT; Vector Backbone:All in One™ vector; Vector Types:Unspecified; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_169782 Copy
Species:
Genetic Insert:
Vector Backbone Description: Backbone Marker:BIOFACT; Vector Backbone:All in One™ vector; Vector Types:Unspecified; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_169780 Copy
Species:
Genetic Insert:
Vector Backbone Description: Backbone Marker:BIOFACT; Vector Backbone:All in One™ vector; Vector Types:Unspecified; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_169779 Copy
Species:
Genetic Insert:
Vector Backbone Description: Vector Backbone:p15A; Vector Types:; Bacterial Resistance:Chloramphenicol
References:
Comments:
Proper citation: RRID:Addgene_169814 Copy
Species:
Genetic Insert:
Vector Backbone Description: Backbone Size:4663; Vector Backbone:pEPIC1.1; Vector Types:Mammalian Expression, Avian expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_169897 Copy
Species:
Genetic Insert:
Vector Backbone Description: Backbone Size:2427; Vector Backbone:pPID2; Vector Types:Cloning Vector; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_169898 Copy
Species: Homo sapiens
Genetic Insert: UDP-N-acetylhexosamine pyrophosphorylase
Vector Backbone Description: Backbone Size:7500; Vector Backbone:pSin4 EF1a IRES Puro; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
References:
Comments: This plasmid was generated in the lab a long time ago and we cannot locate detailed cloning information at this point.
Proper citation: RRID:Addgene_169891 Copy
Species: Synthetic
Genetic Insert: sgRNA targeting ACO1
Vector Backbone Description: Backbone Marker:Broad Institute; Backbone Size:11590; Vector Backbone:pLENTICRISPR V2; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
References:
Comments: Target: CCACTACCCCAACCTGGCGG
Proper citation: RRID:Addgene_169892 Copy
Species: Homo sapiens
Genetic Insert: Vangl2/Strabismus
Vector Backbone Description: Backbone Size:4100; Vector Backbone:pCS2P+; Vector Types:Xenopus Expression; Bacterial Resistance:Ampicillin
References:
Comments: This is a wild type human VANGL2/Strabismuus, cloned into pCS2P+. Injected RNA in zebrafish embryos gives the expected convergent/extension phenotype (Chris Thorpe, unpub. observations).
Reference: Made by Yan Zhang by PCR for RTM. Cloned as a Cla1-Xho1 insert.
Proper citation: RRID:Addgene_16992 Copy
Species: Synthetic
Genetic Insert: sgRNA targeting IREB2
Vector Backbone Description: Backbone Marker:Broad Institute; Backbone Size:11590; Vector Backbone:pLENTICRISPR V2; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
References:
Comments: Target: AATGCACCAAATCCTGGAGG
Proper citation: RRID:Addgene_169894 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the kravitz2 Resources search. From here you can search through a compilation of resources used by kravitz2 and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that kravitz2 has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on kravitz2 then you can log in from here to get additional features in kravitz2 such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into kravitz2 you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within kravitz2 that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.