Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Hepatitis C virus
Genetic Insert: HCV NS5A
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4300; Vector Backbone:pCMVTag1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17404395
Proper citation: RRID:Addgene_17646 Copy
Species: Homo sapiens
Genetic Insert: CRM1
Vector Backbone Description: Backbone Marker:Sigma; Backbone Size:6400; Vector Backbone:p3xFLAG CMV-10; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16041368
Proper citation: RRID:Addgene_17647 Copy
Species: Homo sapiens
Genetic Insert: GLI2
Vector Backbone Description: Backbone Size:4350; Vector Backbone:pCS2-MT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15994174
Proper citation: RRID:Addgene_17649 Copy
Species: Homo sapiens
Genetic Insert: TRERF1 gRNA
Vector Backbone Description: Backbone Marker:addgene ID: 42230; Vector Backbone:pX330; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Comments: gRNA sequence listed also includes (uncloned) PAM
Proper citation: RRID:Addgene_176384 Copy
Species: Synthetic
Genetic Insert: I-SceI sites, Tol2 repeats and Tn5-neo cassette
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:3000; Vector Backbone:pGEM-T; Vector Types:Unspecified; Bacterial Resistance:Ampicillin and Kanamycin
Defining Citation: PMID:34751773
Proper citation: RRID:Addgene_176619 Copy
Species: Aggregatibacter actinomycetemcomitans
Genetic Insert: Dispersin B
Vector Backbone Description: Backbone Size:5313; Vector Backbone:pET29b; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:35379435
Proper citation: RRID:Addgene_176577 Copy
Species: Homo sapiens
Genetic Insert: Cry2PHR-mCherry-IBAR-WH2
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4722; Vector Backbone:pmCherry-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:35987384
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.01.28.478241v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_176603 Copy
Species: Homo sapiens
Genetic Insert: Cry2PHR-mCherry-IBAR
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4722; Vector Backbone:pmCherry-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:35987384
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.01.28.478241v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_176602 Copy
Species: Homo sapiens
Genetic Insert: IBAR-Cry2PHR-mCherry
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4722; Vector Backbone:pmCherry-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:35987384
Comments: Please visit https://www.biorxiv.org/content/10.1101/2022.01.28.478241v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_176604 Copy
Species: Synthetic
Genetic Insert: TagRFP657
Vector Backbone Description: Vector Backbone:pM; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35314781
Comments: Please note: Plasmid contains E38G and L304S mutations in MET17. These mutations are not known to affect plasmid function.
Proper citation: RRID:Addgene_176563 Copy
Species: Synthetic
Genetic Insert: TagRFP657
Vector Backbone Description: Vector Backbone:pH; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35314781
Proper citation: RRID:Addgene_176560 Copy
Species: Ae. Aegypti, Aequorea victoria
Genetic Insert: EGFP
Vector Backbone Description: Vector Backbone:pSL1180; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34819517
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.03.29.437496v2 for bioRxiv preprint.
Proper citation: RRID:Addgene_176681 Copy
Species: Synthetic
Genetic Insert: EF1a-TET3G-P2A-ERT2-Gal4-BGHpA
Vector Backbone Description: Backbone Marker:System Biosciences; Vector Backbone:PiggyBac transposon system; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35050677
Proper citation: RRID:Addgene_176630 Copy
Species: Synthetic
Genetic Insert: TRE3G-12x42bs-10x(BCRbs_BCRbs)-miniCMV-NLS-FKBP12F36V-BCRZFR39A-VP16-NLS-DHFR-IRES-mCherry-PEST-BGHpA
Vector Backbone Description: Backbone Marker:System Biosciences; Vector Backbone:PiggyBac transposon system; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35050677
Proper citation: RRID:Addgene_176626 Copy
Species: Synthetic
Genetic Insert: 14xUAS-12x42bs-10x(ErbB2bs_ErbB2bs)-miniCMV-NLS-FKBP12F36V-ErbB2ZFR2AR39A-VP16-NLS-DHFR-IRES-mTurquoise2-PEST-BGHpA
Vector Backbone Description: Backbone Marker:System Biosciences; Vector Backbone:PiggyBac transposon system; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35050677
Proper citation: RRID:Addgene_176629 Copy
Species: Synthetic
Genetic Insert: 14xUAS-6x42bs-6x(BCRbs_BCRbs)-miniCMV-NLS-FKBP12F36V-BCRZFR39A-VP16-NLS-DHFR-IRES-mCherry-PEST-BGHpA
Vector Backbone Description: Backbone Marker:System Biosciences; Vector Backbone:PiggyBac transposon system; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35050677
Proper citation: RRID:Addgene_176628 Copy
Genetic Insert: pRARE2 + pBADmod1-linker2-gamS plasmid
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:35034449
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.09.07.459228v1 for bioRxiv preprint.
Primers for genomic verification:
Foward - tattttccagtcgtgaaagc
Reverse - ttgctgatttcttccatcag
Primers for GamS plasmid verification:
Forward - aattatgacaacttgacggctacatcattc
Reverse - cgttcaccgacaaacaaca
Proper citation: RRID:Addgene_176584 Copy
Genetic Insert: pRARE2 plasmid
Vector Backbone Description: Vector Backbone:Strain; Vector Types:; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:35034449
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.09.07.459228v1 for bioRxiv preprint.
Primers for recBCD deletion verification:
Foward - ttgatttactgcccgagagc
Reverse - gtcaaccgaatgcagacatc
Proper citation: RRID:Addgene_176583 Copy
Genetic Insert: pRARE2 + pBADmod1-linker2-gamS plasmid
Vector Backbone Description: Vector Backbone:Strain; Vector Types:; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:35034449
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.09.07.459228v1 for bioRxiv preprint.
Primers for recBCD deletion verification:
Foward - ttgatttactgcccgagagc
Reverse - gtcaaccgaatgcagacatc
Primers for GamS plasmid verification:
Forward - aattatgacaacttgacggctacatcattc
Reverse - cgttcaccgacaaacaaca
Proper citation: RRID:Addgene_176586 Copy
Species: Delaware Bay metagenome
Genetic Insert: CRISPR-associate IscB (Delaware Bay) locus
Vector Backbone Description: Backbone Marker:NEB; Backbone Size:4361; Vector Backbone:pBR322; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34591643
Proper citation: RRID:Addgene_176588 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the kravitz2 Resources search. From here you can search through a compilation of resources used by kravitz2 and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that kravitz2 has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on kravitz2 then you can log in from here to get additional features in kravitz2 such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into kravitz2 you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within kravitz2 that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.