Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species:
Genetic Insert: TEAD1
Vector Backbone Description: Backbone Size:4500; Vector Backbone:PCMX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_33108 Copy
Species: Homo sapiens
Genetic Insert: YAP
Vector Backbone Description: Backbone Size:4500; Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_33058 Copy
Species: Homo sapiens
Genetic Insert: YAP
Vector Backbone Description: Backbone Size:4500; Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_33059 Copy
Species: Homo sapiens
Genetic Insert: YAP
Vector Backbone Description: Backbone Size:5000; Vector Backbone:PGEX-KG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_33053 Copy
Species: Homo sapiens
Genetic Insert: TEAD1
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_33047 Copy
Species: Homo sapiens
Genetic Insert: TEAD1
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_33048 Copy
Species: Homo sapiens
Genetic Insert: TEAD1
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_33042 Copy
Species: Homo sapiens
Genetic Insert: TEAD1
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_33043 Copy
Species: Homo sapiens
Genetic Insert: TEAD1
Vector Backbone Description: Backbone Size:4500; Vector Backbone:pCMX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_33036 Copy
Species: Homo sapiens
Genetic Insert: TEAD1
Vector Backbone Description: Backbone Size:4500; Vector Backbone:pCMX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_33034 Copy
Species: Homo sapiens
Genetic Insert: TEAD1
Vector Backbone Description: Backbone Size:4500; Vector Backbone:pCMX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_33037 Copy
Species: Homo sapiens
Genetic Insert: TEAD1
Vector Backbone Description: Backbone Size:4500; Vector Backbone:pCMX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_33038 Copy
Species: Homo sapiens
Genetic Insert: Toca-1
Vector Backbone Description: Backbone Size:4350; Vector Backbone:pCS2+MT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: Molecular cloning of Toca-1 was difficult, because the cDNA encoding human Toca-1 is lethal to E. coli. The toxicity problem was not resolved by using vectors with low copy numbers or with minimal transcriptional activity, suggesting that the source of toxicity was not the translated protein product but rather the DNA sequence itself. The toxic region of the Toca-1 cDNA was localized to codon 127. The Xenopus tropicalis homolog of Toca-1 is completely nontoxic when cloned using E. coli and is identical in amino acid sequence to human Toca-1 between amino acids 124 and 127, but these amino acids are encoded by different codons. Replacing codons 126 and 127 in the human Toca-1 with the X. Tropicalis sequence (which constitute silent mutations) completely ameliorated the toxicity problem and allowed us to propagate the human Toca-1 clone in E. coli without difficulty.
Proper citation: RRID:Addgene_33031 Copy
Species: Homo sapiens
Genetic Insert: Toca-1
Vector Backbone Description: Backbone Size:4350; Vector Backbone:pCS2+MT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: Molecular cloning of Toca-1 was difficult, because the cDNA encoding human Toca-1 is lethal to E. coli. The toxicity problem was not resolved by using vectors with low copy numbers or with minimal transcriptional activity, suggesting that the source of toxicity was not the translated protein product but rather the DNA sequence itself. The toxic region of the Toca-1 cDNA was localized to codon 127. The Xenopus tropicalis homolog of Toca-1 is completely nontoxic when cloned using E. coli and is identical in amino acid sequence to human Toca-1 between amino acids 124 and 127, but these amino acids are encoded by different codons. Replacing codons 126 and 127 in the human Toca-1 with the X. Tropicalis sequence (which constitute silent mutations) completely ameliorated the toxicity problem and allowed us to propagate the human Toca-1 clone in E. coli without difficulty.
Proper citation: RRID:Addgene_33030 Copy
Species: E. coli
Genetic Insert: LacO (256 copies)
Vector Backbone Description: Vector Backbone:Ylplac128; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
References:
Comments: Addgene cannot verify or guarantee the presence of all 256 copies of LacO. This element is unstable.
For use in two-plasmid-based gene-nuclear periphery tethering assay with either plasmids pAK67 (Addgene #33142).
pVS2 (Addgene #33144) contains 256 LacO repeats and a GAL-GFP-GALpA-reporter gene (pVS1 is identical but does not contain the reporter gene). The reporter was previously characterized and contains a GFP open reading frame flanked by the GAL1 promoter and GAL1 3′ UTR ([Abruzzi et al., 2006] and [Dower et al., 2004]).
pKA67 expresses both LacI-GFP and Nup49-GFP to mark the first plasmid as well as the nuclear periphery with GFP.
Proper citation: RRID:Addgene_33143 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: RP51A-synthetic minimal intron
Vector Backbone Description: Vector Backbone:pLGSD5; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
References:
Comments: Original intron sequence: GTATGTTAATATGGTTAACGTCGACCGTGTTTTTGATATCTATACTAACAGGCCTTTTAATAG
Proper citation: RRID:Addgene_33149 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: RP51A-synthetic minimal intron
Vector Backbone Description: Vector Backbone:pLGSD5; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
References:
Comments: Original intron sequence: GTATGTTAATATGGTTAACGTCGACCGTGTTTTTGATATCTATACTAACAGGCCTTTTAATAG
Proper citation: RRID:Addgene_33148 Copy
Species: Homo sapiens
Genetic Insert: PIK3CA
Vector Backbone Description: Backbone Size:5168; Vector Backbone:pBabe puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
References:
Comments: Note from the depositing lab: "This plasmid contains an additional mutation, I143V, that is not thought to alter function of the protein"
Proper citation: RRID:Addgene_33255 Copy
Species: Homo sapiens
Genetic Insert: PIK3CA
Vector Backbone Description: Backbone Size:5168; Vector Backbone:pBabe puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
References:
Comments: Note from the depositing lab: "This plasmid contains an additional mutation, I143V, that is not thought to alter function of the protein"
Proper citation: RRID:Addgene_33254 Copy
Species: Homo sapiens
Genetic Insert: ELK1
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:5051; Vector Backbone:pFC14K; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_33258 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the kravitz2 Resources search. From here you can search through a compilation of resources used by kravitz2 and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that kravitz2 has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on kravitz2 then you can log in from here to get additional features in kravitz2 such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into kravitz2 you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within kravitz2 that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Data set from Kravitz, Owen and Kretizer's 2012 paper "Optogenetic identification of striatal projection neuron subtypes during in vivo recordings."
