Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
V. natriegens NC1 Resource Report Resource Website |
RRID:Addgene_215355 | na | None | PMID:38352175 | Genotype: ATCC14048 + ∆dns + camR + tfoX + lacI (nonfunctional). Supporting References: Chromosome 1 sequence: https://benchling.com/s/seq-9rfOeT70F35Li9CNjCnA?m=slm-n4lGsmu5T0KaunpiH620. Culture in LBv2 or LBv3 broth with 2ug/mL chloramphenicol. Recipe for LBv2: https://www.protocols.io/view/growth-media-for-v-natriegens-kqdg349j7l25/v1. Please visit https://www.biorxiv.org/content/10.1101/2023.08.11.553013v1 for bioRxiv preprint. | Vector Backbone:na; Vector Types:; Bacterial Resistance:None | 2026-07-25 01:00:00 | 0 | ||
|
V. natriegens NC7 Resource Report Resource Website |
RRID:Addgene_215356 | na | None | PMID:38352175 | This is the NC1 strain (Addgene #215355) with a deletion of the camR gene. Genotype: ATCC14048 + ∆dns + tfoX + lacI (nonfunctional). Supporting References: Chromosome 1 sequence: https://benchling.com/s/seq-HxxOFAiNbpHxSWT82Qju?m=slm-bQ5JkVI3VTiy0fDMPYr8. Recipe for LBv2: https://www.protocols.io/view/growth-media-for-v-natriegens-kqdg349j7l25/v1. Please visit https://www.biorxiv.org/content/10.1101/2023.08.11.553013v1 for bioRxiv preprint. | Vector Backbone:na; Vector Types:; Bacterial Resistance:None | 2026-07-25 01:00:00 | 0 | ||
|
E. coli MEV20 Resource Report Resource Website |
RRID:Addgene_197113 | None | E. coli MEV15 is engineered to host diterpenoid biosynthetic pathways. Diterpenoid production is achieved by supplying the strain with plasmids encoding terpene cyclase(s) and cytochrome P450s under the control of Marionette promoters (See https://www.addgene.org/kits/marionette-sensor-collection/ and 10.1038/s41589-018-0168-3). Diterpenoid production can be induced by IPTG, vanillic acid, and other inducers controlling cytorhcome P450s. The strain has the upper MEV pathway from pMevT (addgene #17815) inserted into 4418413/4418414, the lower MEV pathway from pMBIS (addgene #17817) and Streptomyces avermitilis ggps inserted into 4105665/4105664, the designed redox enzyme array inserteed into 3801913/3801912, and the Marionette cluster from sAJM.1506 (addgene #108254) inserted into 3753777/3752159 of E. coli BL21(DE3)'s genome. The nucleotide numbers are based on NCBI accession # NZ_CP053602. The redox enzyme array consists of fprD/fdxD from Streptomyces avermitilis, fpr/fldA from E. coli, fenr/fer1 from spinach chloroplasts, abd pdr/pdx (camA/camB) from Pseudomonas putida. The Marionette cluster was transferred using phage transduction, resulting in the replacement of nucleotides between 3745758/3839292 by those in the corresponding regions from sAJM.1506 (parent strain: E. coli MG1655), as evident by whole-genome sequencing. | Vector Backbone:N/A; Vector Types:; Bacterial Resistance:None | 2026-07-25 12:58:09 | 0 | ||||
|
pMBA334 Resource Report Resource Website |
RRID:Addgene_214746 | BBa_J23119-RiboJ-RBS(21992)-gfpmut3 | other | None | PMID:38086386 | Vector Backbone:colE1 ; Vector Types:Bacterial Expression; Bacterial Resistance:None | 2026-07-25 01:00:48 | 0 | ||
|
pMBA327 Resource Report Resource Website |
RRID:Addgene_214747 | BBa_J23119-RBS(22821)-mcherry | other | None | PMID:38086386 | Please note: Plasmid contains three mutations in Rep101. These mutations are not known to affect plasmid function. | Vector Backbone:pSC101 ; Vector Types:Bacterial Expression; Bacterial Resistance:None | 2026-07-25 01:00:48 | 0 | |
|
pMBA328 Resource Report Resource Website |
RRID:Addgene_214748 | BBa_J23119-RBS(22821)-mcherry | other | None | PMID:38086386 | Please note: Plasmid contains R334H and A76T mutations in glmS. These mutations are not known to affect plasmid function. | Vector Backbone:p15A ; Vector Types:Bacterial Expression; Bacterial Resistance:None | 2026-07-25 01:00:48 | 0 | |
|
bMS.346 Resource Report Resource Website 1+ mentions |
RRID:Addgene_220588 | exoI- recJ- araB::T7RNAP-tetA | n/a | None | PMID:34949838 | Strain was validated by shotgun sequencing using Illumina Nextseq. Supporting References: Bhattarai-Kline, S., Lear, S.K., Fishman, C.B. et al. Recording gene expression order in DNA by CRISPR addition of retron barcodes. Nature 608, 217–225 (2022). https://doi.org/10.1038/s41586-022-04994-6. González-Delgado A, Lopez SC, Rojas-Montero M, Fishman CB, Shipman SL. Simultaneous multi-site editing of individual genomes using retron arrays. bioRxiv [Preprint]. 2023 Jul 17:2023.07.17.549397. doi: 10.1101/2023.07.17.549397. PMID: 37503029; PMCID: PMC10370050. | Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None | 2026-07-25 01:01:07 | 1 | |
|
Z956 Resource Report Resource Website |
RRID:Addgene_200838 | Genotype: MG1655 rph+, ilvG+, ΔlacZ, ΔrapZ, ΔglmZ, ΔglmY | Escherichia coli str. K-12 substr. MG1655 | None | PMID:36987877 | Primer to check deletions: ΔrapZ (5' check primer: GGATACCGAAGGTACTCCGG; 3' check primer: CGTAAGAGCACTTCAGCGTC); ΔglmZ (5' check primer: GTGTAGGATCAAGCTCAGG; 3' check primer: CGGACGCCTACGATTACGC); ΔglmY (5' check primer: GTCTCTTTTTAGCGACACAGTGGC; 3' check primer: GGTGTTACTCTCGTCAGACGCG) | Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None | rapZ, glmZ and glmY are deleted to avoid interference with plasmid-encoded genes | 2026-07-25 12:58:23 | 0 |
|
E. coli BW25113 ΔtnaA ΔtrpR Resource Report Resource Website |
RRID:Addgene_205015 | ΔtnaA ΔtrpR | E. coli | None | PMID:35594503 | Primers for PCR verification: veri-trpR-F: AGCAGCTTATAACGCCGGACCAGGG veri-trpR-R: TGGTCCCGTGATGTCGCGTTATAC veri-tnaA-F: CTTGTTTTAGTAAATGATGGTGCTTG veri-tnaA-R: GATCAGTCATGATGCCACCTTTAGAG | Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None | 2026-07-25 12:58:27 | 0 | |
|
BL21(DE3) ΔserC Resource Report Resource Website 1+ mentions |
RRID:Addgene_197656 | This strain is a derivative of BL21(DE3) with the serC gene knocked out | n/a | None | PMID:37122473 | Strain is resistant to chloramphenicol. Derivative of BL21(DE3) with the serC gene knocked out. This strain is used for expressing proteins containing site-specific non-hydrolyzable phosphoserine. Primers for verification: - for serC deletion: CCTCAACGGTTTTACTCATTGCGATG, CGGGCAGATTAATAGTGCCATCGAC Additional reference: Rogerson et al. Efficient genetic encoding of phosphoserine and its nonhydrolyzable analog. Nat Chem Biol. 2015 Jul;11(7):496-503 Please visit https://www.biorxiv.org/content/10.1101/2021.10.22.465468v2 for bioRxiv preprint. | Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None | 2026-07-25 12:57:30 | 1 | |
|
TB205 △ilvA Resource Report Resource Website |
RRID:Addgene_230042 | MG1655 attP21::PR-mCherry::frt ilvA::frt | None | PMID:37903278 | Strain Validation: Fluorescence, growth in M9+glucose +/- isoleucine, PCRs with primers flanking fluorescent marker gene or deleted gene. Primers: ilvA_fwd: ATCGTGAACGTCAGGTCTCC ilvA_rev: TCTGGAAGATTTTGCCGAAC | Vector Backbone:NA; Vector Types:; Bacterial Resistance:None | 2026-07-25 01:02:37 | 0 | ||
|
TB204 △ilvA Resource Report Resource Website |
RRID:Addgene_230041 | MG1655 attP21::PR-sfGFP::frt ilvA::frt | None | PMID:37903278 | Strain Validation: Fluorescence, growth in M9+glucose +/- isoleucine, PCRs with primers flanking fluorescent marker gene or deleted gene. Primers: ilvA_fwd: ATCGTGAACGTCAGGTCTCC ilvA_rev: TCTGGAAGATTTTGCCGAAC | Vector Backbone:NA; Vector Types:; Bacterial Resistance:None | 2026-07-25 01:02:37 | 0 | ||
|
TB205 △metA Resource Report Resource Website |
RRID:Addgene_230040 | MG1655 attP21::PR-mCherry::frt metA::frt | None | PMID:37903278 | Strain Validation: Fluorescence, growth in M9+glucose +/- methionine, PCRs with primers flanking fluorescent marker gene or deleted gene. Primers: metA_fwd: CGTGAGCGGCGAATACTAAT metA_rev: AAACTTCCCCACTGTGAAC | Vector Backbone:NA; Vector Types:; Bacterial Resistance:None | 2026-07-25 01:02:37 | 0 | ||
|
TB204 △proC Resource Report Resource Website |
RRID:Addgene_230035 | MG1655 attP21::PR-sfGFP::frt proC::frt | None | PMID:32042125 | Strain Validation: Fluorescence, growth in M9+glucose +/- proline, PCRs with primers flanking fluorescent marker gene or deleted gene. Primers: proC_fwd: CATAAAGTCATCCTTTGTTGGG proC_rev: CTTTACGGATTAGTGTGGGG | Vector Backbone:NA; Vector Types:; Bacterial Resistance:None | 2026-07-25 01:02:37 | 0 | ||
|
TB204 △metA Resource Report Resource Website |
RRID:Addgene_230039 | MG1655 attP21::PR-sfGFP::frt metA::frt | None | PMID:37903278 | Strain Validation: Fluorescence, growth in M9+glucose +/- methionine, PCRs with primers flanking fluorescent marker gene or deleted gene. Primers: metA_fwd: CGTGAGCGGCGAATACTAAT metA_rev: AAACTTCCCCACTGTGAAC | Vector Backbone:NA; Vector Types:; Bacterial Resistance:None | 2026-07-25 01:02:37 | 0 | ||
|
TB205 △proC Resource Report Resource Website |
RRID:Addgene_230036 | MG1655 attP21::PR-mCherry::frt proC::frt | None | PMID:32042125 | Strain Validation: Fluorescence, growth in M9+glucose +/- proline, PCRs with primers flanking fluorescent marker gene or deleted gene. Primers: proC_fwd: CATAAAGTCATCCTTTGTTGGG proC_rev: CTTTACGGATTAGTGTGGGG | Vector Backbone:NA; Vector Types:; Bacterial Resistance:None | 2026-07-25 01:02:37 | 0 | ||
|
MG1655 tnaA- Resource Report Resource Website |
RRID:Addgene_228513 | tnaA- | n/a | None | PMID:39610115 | Derived from E. coli K-12 MG1655 strain. This strain does not produce indole as measured with Kovac's Reagent Indole Test. A T7 phage strain with a gp1 KO is available from the Whitehead Lab. Please visit https://doi.org/10.1101/2024.08.07.607023 for bioRxiv preprint. | Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None | 2026-07-25 01:02:40 | 0 | |
|
TK310 Resource Report Resource Website |
RRID:Addgene_196340 | ΔcyaA ΔcpdA ΔlacY | n/a | None | PMID:17376875 | Primers: oSK285, cpdA-fwd: GAGTGGGCATAAATGAAGCG oSK286, cpdA-rev: CACTGCGGGCAGCATAAA oSK287, lacY-fwd: CCGGTCGCTACCATTACCAG oSK288, lacY-rev: CTTTCGGTCATTGGCATGTTC oSK289, CyaA-fwd: GCGCATCTTTCTTTACGGTC oSK290, CyaA-rev: GCTGCACCAGGTATGGCT | Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None | 2026-07-25 01:05:08 | 0 | |
|
CZ105 Resource Report Resource Website |
RRID:Addgene_242527 | DH10B[lcl857(cro-bioA), araC PBADflpe, PrhaphiC31] | E. coli | None | PMID:40493021 | Vector Backbone:n/a; Vector Types:Synthetic Biology; Bacterial Resistance:None | 2026-07-25 01:05:12 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the kravitz2 Resources search. From here you can search through a compilation of resources used by kravitz2 and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that kravitz2 has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on kravitz2 then you can log in from here to get additional features in kravitz2 such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into kravitz2 you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Data set from Kravitz, Owen and Kretizer's 2012 paper "Optogenetic identification of striatal projection neuron subtypes during in vivo recordings."
