Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species:
Genetic Insert:
Vector Backbone Description: Vector Backbone:N/A; Vector Types:; Bacterial Resistance:None
References:
Comments: E. coli MEV15 is engineered to host diterpenoid biosynthetic pathways. Diterpenoid production is achieved by supplying the strain with plasmids encoding terpene cyclase(s) and cytochrome P450s under the control of Marionette promoters (See https://www.addgene.org/kits/marionette-sensor-collection/ and 10.1038/s41589-018-0168-3). Diterpenoid production can be induced by IPTG, vanillic acid, and other inducers controlling cytorhcome P450s. The strain has the upper MEV pathway from pMevT (addgene #17815) inserted into 4418413/4418414, the lower MEV pathway from pMBIS (addgene #17817) and Streptomyces avermitilis ggps inserted into 4105665/4105664, the designed redox enzyme array inserteed into 3801913/3801912, and the Marionette cluster from sAJM.1506 (addgene #108254) inserted into 3753777/3752159 of E. coli BL21(DE3)'s genome. The nucleotide numbers are based on NCBI accession # NZ_CP053602. The redox enzyme array consists of fprD/fdxD from Streptomyces avermitilis, fpr/fldA from E. coli, fenr/fer1 from spinach chloroplasts, abd pdr/pdx (camA/camB) from Pseudomonas putida. The Marionette cluster was transferred using phage transduction, resulting in the replacement of nucleotides between 3745758/3839292 by those in the corresponding regions from sAJM.1506 (parent strain: E. coli MG1655), as evident by whole-genome sequencing.
Proper citation: RRID:Addgene_197113 Copy
Species: n/a
Genetic Insert: This strain is a derivative of BL21(DE3) with no specific assignment of the UAG codo
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None
References:
Comments: Derivative of BL21(DE3) with no specific assignment of the UAG codon
- 95 endogenous TAG codons mutated to TAA
- RF1 (prfA) deleted and fabR spontaneously mutated
- serB deleted for phosphoserine genetic code expansion expression applications
Primers for verification:
- for RF1 (prfA) deletion: AAGCCTTCTATCGTTGCCAAAC, TTATTCCTGCTCGGACAACG
- for serB deletion: AGTTTTGTGCGAGCCATCTTCCACC, GTGATGGTGTTCCAGGCATGACAGG
This strain is used for expressing phosphoserine-containig proteins using genetic code expansion without buildup of prematurely truncated protein
- Recommended plasmids for expressing phosphorylated proteins in this strain are Addgene #173897 (pSer GCE machinery vector) and #174075/174076 (compatible p15a origin of replication plasmids expressing sfGFP proteins from a T7 promoter; sfGFP genes can be removed by restriction digest and replaced with protein-of-interest).
Original B95 strain: Mukai, T., Highly reproductive Escherichia coli cells with no specific assignment to the UAG codon. Sci. Rep. 5: 9699 (2015). PMID 25982672
Proper citation: RRID:Addgene_197655 Copy
Species: n/a
Genetic Insert: This strain is a derivative of BL21(DE3) with the serC gene knocked out
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None
References:
Comments: Strain is resistant to chloramphenicol.
Derivative of BL21(DE3) with the serC gene knocked out. This strain is used for expressing proteins containing site-specific non-hydrolyzable phosphoserine.
Primers for verification:
- for serC deletion: CCTCAACGGTTTTACTCATTGCGATG, CGGGCAGATTAATAGTGCCATCGAC
Additional reference: Rogerson et al. Efficient genetic encoding of phosphoserine and its nonhydrolyzable analog. Nat Chem Biol. 2015 Jul;11(7):496-503
Please visit https://www.biorxiv.org/content/10.1101/2021.10.22.465468v2 for bioRxiv preprint.
Proper citation: RRID:Addgene_197656 Copy
Species:
Genetic Insert: none
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
References:
Comments: E. coli K12 MG1655 genotype: F- λ- ilvG- rfb-50 rph-1
Integration at lambda attB: pOSIP-KL-mCherry
Integration at primary 186 attB: pOSIP-CO-RBS-librarydCas9 (2-3)*
*Number in parentheses refers to the selected colony number.
mCherry quantifies dCas9 repression
Proper citation: RRID:Addgene_115925 Copy
Species:
Genetic Insert:
Vector Backbone Description: Vector Backbone:None; Vector Types:; Bacterial Resistance:None
References:
Comments: To prevent possible enzymatic dephosphorylation of O-phospho-L-serine (Sep) in vivo, the gene encoding phosphoserine phosphatase (serB), which catalyzes the last step in serine biosynthesis, was deleted from Escherichia coli strain Top10. Markerless gene deletions were carried out using a λ-red and FLP recombinase-based gene knockout strategy.
Proper citation: RRID:Addgene_34928 Copy
Species:
Genetic Insert: None
Vector Backbone Description: Vector Backbone:None; Vector Types:; Bacterial Resistance:None
References:
Comments: We recommend growth of the EcAR7 strain at 30 °C in LB supplemented with 0.08% glucose. The EcAR7 strains normally take 1.5-‐2 days to grow at 30°C, after transformation or streaking the strain on an agar plate (with the appropriate antibiotics).
See supplemental information from referenced article for protocol on creating EcAR7 from EcNR2.
Proper citation: RRID:Addgene_52055 Copy
Species:
Genetic Insert: Oplac2 (37)-KI strain
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
References:
Comments: To test whether the mRNA secondary structure of our codon redesigned sequences affected expression, we substituted the first 37 nucleotides of KIlac with those of OpLac2.
Proper citation: RRID:Addgene_52702 Copy
Species:
Genetic Insert: ΔYA strain
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
References:
Comments: lacY and lacA deletion
Proper citation: RRID:Addgene_52708 Copy
Species:
Genetic Insert: ΔZA strain
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
References:
Comments: lacZ and lacA deletion
Proper citation: RRID:Addgene_52707 Copy
Species:
Genetic Insert: W999L strain
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
References:
Comments:
Proper citation: RRID:Addgene_52713 Copy
Species:
Genetic Insert: E537Q strain
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
References:
Comments:
Proper citation: RRID:Addgene_52714 Copy
Species:
Genetic Insert: G794A strain
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
References:
Comments:
Proper citation: RRID:Addgene_52711 Copy
Species:
Genetic Insert: W999F strain
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
References:
Comments:
Proper citation: RRID:Addgene_52712 Copy
Species:
Genetic Insert: ΔZYA strain
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
References:
Comments: MG1655 was transformed with pKD46 (carrying phage lambda Red recombinase) and a PCR fragment encoding a kanamycin resistance gene with flanking nucleotide sequences homologous to those flanking the lac operon. Upon recombination and selection for resistant strains, the kanamycin-resistant gene was eliminated following transformation with pCP20 (encoding the FLP recombinase), which is subsequently cured by growth at 30°C. The deletion in our ΔZYA strain started 20bp upstream of lacI and ran 40bp downstream of lacA.
Proper citation: RRID:Addgene_52695 Copy
Species:
Genetic Insert: OpLac1-Δ6 strain
Vector Backbone Description: Vector Backbone:na; Vector Types:; Bacterial Resistance:None
References:
Comments: Oplac1Δ6 were erroneously synthesized missing the first 6 nucleotides of Oplac1. These deletions correspond to the first 2 N-terminal amino acid residues (Methionine and Threonine), and instead begin at the Methionine at position 3.
Proper citation: RRID:Addgene_52698 Copy
Species:
Genetic Insert: single chromosomal copy of yhhX target sequence upstream from mcherry reporter gene under control of a constitutive promoter
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
References:
Comments: Genotype:
The expression of mcherry can be visualized or measured with a spectrophotometer.
The yhhX target sequence followed by a mcherry reporter gene carried by an integrative vector based on pOSIP-KL was integrated at the lambda attB site in the chromosome of E. coli MG1655 and the backbone was flipped out using the pE-FLP (AmpR, #45978, Addgene) plasmid.
This strain can be used to optimize dCas9 expression levels
Proper citation: RRID:Addgene_125258 Copy
Species:
Genetic Insert: Strain
Vector Backbone Description: Vector Backbone:Strain; Vector Types:; Bacterial Resistance:None
References:
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.09.07.459228v1 for bioRxiv preprint.
Primers for recB deletion verification:
Foward - tattttccagtcgtgaaagc
Reverse - ttgctgatttcttccatcag
Proper citation: RRID:Addgene_176580 Copy
Species: E.coli
Genetic Insert: none
Vector Backbone Description: Vector Backbone:none; Vector Types:Synthetic Biology; Bacterial Resistance:None
References:
Comments:
Proper citation: RRID:Addgene_52942 Copy
Species: E.coli
Genetic Insert: none
Vector Backbone Description: Vector Backbone:none; Vector Types:Synthetic Biology; Bacterial Resistance:None
References:
Comments:
Proper citation: RRID:Addgene_52950 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the kravitz2 Resources search. From here you can search through a compilation of resources used by kravitz2 and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that kravitz2 has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on kravitz2 then you can log in from here to get additional features in kravitz2 such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into kravitz2 you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within kravitz2 that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.