Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.wormbase.org/db/get?name=WBStrain00047599
Proper Citation: RRID:WB-STRAIN:WBStrain00047599
Description: Caenorhabditis elegans with name R05D3.8(gk5088[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/qC1[dpy-19(e1259) glp-1(q339)] III. from WB.
Species: Caenorhabditis elegans
Synonyms: R05D3.8(gk5088[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/qC1[dpy-19(e1259) glp-1(q339)] III.
Notes: Homozygous lethal or sterile deletion balanced by qC1. Deletion of 1366 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain; homozygous qC1 is non-GFP sterile TS Dpy. Left flanking sequence: TCATTTTGTATAATGTTTTATTCTCGGTCA; Right flanking sequence: GGAGGTAGAATGCACTCGTATAAAGTTCCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group"
Affected Gene: WBGene00001078(dpy-19)|WBGene00001609(glp-1)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for R05D3.8(gk5088[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/qC1[dpy-19(e1259) glp-1(q339)] III..
No alerts have been found for R05D3.8(gk5088[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/qC1[dpy-19(e1259) glp-1(q339)] III..
Source: WormBase (RRID:SCR_003098)
Description: Central data repository for nematode biology including complete genomic sequence, gene predictions and orthology assignments from range of related nematodes.Data concerning genetics, genomics and biology of C. elegans and related nematodes. Derived from initial ACeDB database of C. elegans genetic and sequence information, WormBase includes genomic, anatomical and functional information of C. elegans, other Caenorhabditis species and other nematodes. Maintains public FTP site where researchers can find many commonly requested files and datasets, WormBase software and prepackaged databases.
URL: http://www.wormbase.org
Source Database: WormBase (WB)