Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.wormbase.org/db/get?name=WBStrain00040303
Proper Citation: RRID:WB-STRAIN:WBStrain00040303
Description: Caenorhabditis elegans with name mir-795(ma298) I; maIs105 V. from WB.
Species: Caenorhabditis elegans
Synonyms: mir-795(ma298) I; maIs105 V.
Notes: maIs105 [col-19::GFP] V. mir-795(ma298) enhances retarded phenotypes of mir-48 mir-241 (nDF51). ma298 allele is missing the 5 nucleotides between CCGAGAAACGTTACCTGCT and AGATTGATCAGCGAGCTTGA [chrI:12,594,565-12,594,608 of WBcel235/ce11].
Affected Gene: WBGene00045329(mir-795)
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for VT3299.
No alerts have been found for VT3299.
Source: Integrated Animals
Source Database: WormBase (WB)
Data set from Kravitz, Owen and Kretizer's 2012 paper "Optogenetic identification of striatal projection neuron subtypes during in vivo recordings."
