Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5144102
Proper Citation: RRID:RGD_5144102
Description: Rattus norvegicus with name ACI.FHH-(D1Mit18-D1Rat90)(D14Mit11-D14Rat33)(D14Rat65-D14Rat90)/EurMcwi-Asipem1Mcwi from RGD.
Species: Rattus norvegicus
Notes: This strain was produced by injecting ZFNs targeting the sequence agccacctggtatttgaggagacgcttggagatgac into ACI.FHH(D1Mit18-D1Rat90)(D14Mit11-D14Rat33)(D14Rat65-D14Rat90) embryos. The result is a 5-bp frameshift deletion in exon 2.
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for ACI.FHH-(D1Mit18-D1Rat90)(D14Mit11-D14Rat33)(D14Rat65-D14Rat90)/EurMcwi-Asipem1Mcwi.
No alerts have been found for ACI.FHH-(D1Mit18-D1Rat90)(D14Mit11-D14Rat33)(D14Rat65-D14Rat90)/EurMcwi-Asipem1Mcwi.
Source: Integrated Animals
Source Database: Rat Genome Database (RGD)
Data set from Kravitz, Owen and Kretizer's 2012 paper "Optogenetic identification of striatal projection neuron subtypes during in vivo recordings."
