Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=405649860
Proper Citation: RRID:RGD_405649860
Description: Rattus norvegicus with name SD-Esr1em1Bra-/- from RGD.
Species: Rattus norvegicus
Notes: Two target sequences (GCCGTGTTCAACTACCCCGAGGG and GCTGCGCAAGTGTTACGAAGTGG) within the second and third exon, respectively, of the coding sequence of Esr1 (the rat gene encoding ERα) were selected. gRNAs targeting these sequences were synthesized via in vitro transcription. gRNAs (25 ng/ul each) were co- microinjected with Cas9 protein (40 ng/ul) into Sprague-Dawley rat embryos, and embryos were transferred into pseudo-pregnant recipients. Animals heterozygous for a 25 base pair deletion in Esr1 exon 3 were used to establish an ER alpha mutant colony and subsequent homozygous mutant offspring were obtained for study. Department of Medicine, Division of Pulmonary, Critical Care, Sleep and Occupational Medicine, Indiana University School of Medicine, Indianapolis, Indiana, USA.
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for SD-Esr1em1Bra-/-.
No alerts have been found for SD-Esr1em1Bra-/-.
Source: Integrated Animals
Source Database: Rat Genome Database (RGD)
Data set from Kravitz, Owen and Kretizer's 2012 paper "Optogenetic identification of striatal projection neuron subtypes during in vivo recordings."
