Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=38599189
Proper Citation: RRID:RGD_38599189
Description: Rattus norvegicus with name F344-Rag2em1Iexas from RGD.
Species: Rattus norvegicus
Notes: This strain was established by targeting Rag2 gene in F344/Jcl using CRISPR/Cas9 system. gRNA to Rag2: AACATAGCCTTAATTCAACCAGG (PAM: last AGG); Cas 9 mRNA transcribed from T7-NLS hCas9-pA (RDB13130) was used for the system. Gene transfer was performed by electroporation. This strain shows severe combined immunodeficiency (SCID) caused by 1-bp insertion in Rag2 gene on chromosome 3. This strain grows normally under SPF condition. National BioResource Project for the Rat in Japan
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for F344-Rag2em1Iexas.
No alerts have been found for F344-Rag2em1Iexas.
Source: Integrated Animals
Source Database: Rat Genome Database (RGD)
Data set from Kravitz, Owen and Kretizer's 2012 paper "Optogenetic identification of striatal projection neuron subtypes during in vivo recordings."
