Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.addgene.org/112023
Proper Citation: RRID:Addgene_112023
Insert Name: NYESO alpha into TRAC HDRT
Organism: Homo sapiens
Bacterial Resistance: Ampicillin
Defining Citation: PMID:29995861
Vector Backbone Description: Backbone Size:2686; Vector Backbone:pUC19; Vector Types:CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin
Comments: gRNA sequence that can be used with this DNA template: AGAGTCTCTCAGCTGGTACA
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for NYESO alpha into TRAC HDRT Source (pTR 223).
No alerts have been found for NYESO alpha into TRAC HDRT Source (pTR 223).
Source: Addgene