Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.addgene.org/64972
Proper Citation: RRID:Addgene_64972
Insert Name: syndecan 2
Organism: Homo sapiens
Bacterial Resistance: Ampicillin
Defining Citation: PMID:24662262
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: Cloning by PCR using oligo (ccactgcttactggcatgcggcgcgcgtggatc) that links the 3' region of CMV promoter of pCDNA3 to the SDC2 signal peptide and the oligo (ctagaaggcacagtcgcagtgatctcataaaatagagacac) that links the polyadenilation site of bovine growth hormone in pcDNA3 to the 3'UTR of SDC2 (FAAF).
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for human syndecan 2 FAAF.
No alerts have been found for human syndecan 2 FAAF.
Source: Addgene
Data set from Kravitz, Owen and Kretizer's 2012 paper "Optogenetic identification of striatal projection neuron subtypes during in vivo recordings."
