Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.addgene.org/22747
Proper Citation: RRID:Addgene_22747
Insert Name: shRev-Erbalpha
Organism: Mus musculus
Bacterial Resistance: Ampicillin
Defining Citation: PMID:20018698
Vector Backbone Description: Backbone Marker:Available at Addgene (#8453); Backbone Size:7000; Vector Backbone:pLKO.1; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Comments: targeting sequence: GCGCTTTGCATCGTTGTTCAA
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for pLKO-1 shRev-Erbalpha.
No alerts have been found for pLKO-1 shRev-Erbalpha.
Source: Addgene
Data set from Kravitz, Owen and Kretizer's 2012 paper "Optogenetic identification of striatal projection neuron subtypes during in vivo recordings."
