Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.addgene.org/200838
Proper Citation: RRID:Addgene_200838
Insert Name: Genotype: MG1655 rph+, ilvG+, ΔlacZ, ΔrapZ, ΔglmZ, ΔglmY
Organism: Escherichia coli str. K-12 substr. MG1655
Bacterial Resistance: None
Defining Citation: PMID:36987877
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None
Comments: Primer to check deletions: ΔrapZ (5' check primer: GGATACCGAAGGTACTCCGG; 3' check primer: CGTAAGAGCACTTCAGCGTC); ΔglmZ (5' check primer: GTGTAGGATCAAGCTCAGG; 3' check primer: CGGACGCCTACGATTACGC); ΔglmY (5' check primer: GTCTCTTTTTAGCGACACAGTGGC; 3' check primer: GGTGTTACTCTCGTCAGACGCG)
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for Z956.
No alerts have been found for Z956.
Source: Addgene
Data set from Kravitz, Owen and Kretizer's 2012 paper "Optogenetic identification of striatal projection neuron subtypes during in vivo recordings."
