Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.addgene.org/197656
Proper Citation: RRID:Addgene_197656
Insert Name: This strain is a derivative of BL21(DE3) with the serC gene knocked out
Organism: n/a
Bacterial Resistance: None
Defining Citation: PMID:37122473
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None
Comments: Strain is resistant to chloramphenicol. Derivative of BL21(DE3) with the serC gene knocked out. This strain is used for expressing proteins containing site-specific non-hydrolyzable phosphoserine. Primers for verification: - for serC deletion: CCTCAACGGTTTTACTCATTGCGATG, CGGGCAGATTAATAGTGCCATCGAC Additional reference: Rogerson et al. Efficient genetic encoding of phosphoserine and its nonhydrolyzable analog. Nat Chem Biol. 2015 Jul;11(7):496-503 Please visit https://www.biorxiv.org/content/10.1101/2021.10.22.465468v2 for bioRxiv preprint.
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for BL21(DE3) ΔserC.
No alerts have been found for BL21(DE3) ΔserC.
Source: Addgene
Data set from Kravitz, Owen and Kretizer's 2012 paper "Optogenetic identification of striatal projection neuron subtypes during in vivo recordings."
