Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.addgene.org/180310
Proper Citation: RRID:Addgene_180310
Bacterial Resistance: None
Defining Citation: PMID:35077145
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
Comments: Genotype: E. coli MG1655ΔCRISPR-Cas Method: Knockout using pKD46/pKD4 Created by: Baiyang Liu Knockout region from MG1655 genome: 995605 to 1006007 Primer Fw: GATTATCGACTGGGATAACC Primer Rv: CAGAAATATTCGACAAAGCG Expected PCR size for JEC027: 1kb Expected PCR size for MG1655: 10.4kb
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for JEC027.
No alerts have been found for JEC027.
Source: Addgene
Data set from Kravitz, Owen and Kretizer's 2012 paper "Optogenetic identification of striatal projection neuron subtypes during in vivo recordings."
