Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
NURSA PCR Primers contain primer sequences to amplify nuclear receptors. As of March 20, 2020, NURSA is succeeded by the Signaling Pathways Project (SPP). All NURSA-biocurated transcriptomic datasets have been preserved for data mining in SPP. All non-transcriptomic dataset NURSA content will be transferred to dkNET, with whom we are evaluating options for archiving this content.
(last updated: Mar 24, 2020)
This source has been archived. We are no longer crawling it or it is no longer updating with new data.
Information MoleculeName | Molecule | Forward Primer | Reverse Primer | Organism | cDNA Template |
---|---|---|---|---|---|
MR Primer | NR3C2 | agcaggcctttgaggtcatt | aaggccccaccattcatg | House Mouse | |
COUP-TFII Primer | NR2F2 | gcatgagacgggaagctgtac | cgttggtcagggcaaactg | House Mouse | NM_009697.3 |
DAX1 Primer | NR0B1 | aagggaccgtgctctttaacc | tctccactgaagaccctcaatgt | House Mouse | NM_007430.4 |
ERR-β Primer | ESRRB | cagatcgggagcttgtgttc | tggtccccaagtgtcagact | House Mouse | NM_011934.4 |
ER-β Primer | ESR2 | gccaacctcctgatgcttct | tcgtacaccgggaccacat | House Mouse | NM_010157.3 |
DAX1 Primer B | NR0B1 | tccggtggtgctgatcaa | tctccactgaagaccctcaatgt | House Mouse | NM_007430.4 |
DAX1 Primer A | NR0B1 | aagggaccgtgctctttaacc | tctccactgaagaccctcaatgt | House Mouse | NM_007430.4 |
ER-α Primer | ESR1 | gcagatagggagctggttca | tggagattcaagtccccaaa | House Mouse | NM_007956.4 |
EAR2 Primer | NR2F6 | gagggctgcaagagtttcttc | tccggtggtgctgatcaa | House Mouse | NM_010150.2 |
COUP-TFI Primer | NR2F1 | tgctattcacgtcagatgcttgt | cagggcacactgtgatttctc | House Mouse | NM_010151.2 |
ERR-α Primer | ESRRA | agcaagccccgatgga | gagaagcctgggatgctctt | House Mouse | NM_007953.2 |
AR Primer | AR | tgtcaactccaggatgctctact | tggctgtacatccgagacttg | House Mouse | NM_013476.3 |
CAR Primer | NR1I3 | gctgcaagggcttcttcag | aacggacagatgggaccaa | House Mouse | NM_009803.5 |
ERR-γ Primer | ESRRG | acttggctgaccgagagttg | gccagggacagtgtggagaa | House Mouse | NM_011935.3 |
FXR-α Primer | NR1H4 | tccggacattcaaccatcac | tcactgcacatcccagatctc | House Mouse | NM_009108.2 |
FXR-β Primer | FXR-β | catacaagggctaatgaagtttacca | ttttgacgccttctgtaatgc | House Mouse | NM_198658.2 |
GR Primer | NR3C1 | gcaagtggaaacctgctatgc | catacatgcagggtagagtcattctt | House Mouse | NM_008173.3 |
HNF4-α Primer | HNF4A | accaagaggtccatggtgttt | gtgccgagggacgatgtag | House Mouse | NM_008261.2 |
HNF4-γ Primer | HNF4G | atgaccaggtggccctctt | tgtagctccaagcagcagatg | House Mouse | NM_013920.2 |
GCNF Primer | NR6A1 | cctccctcacagtgtacagcaa | tgtgatataggtagatgagtcgttcaa | House Mouse | NM_010264.4 |
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.