Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Search

Type in a keyword to search

On page 1 showing 1 ~ 20 out of 2,338 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection

http://www.wormbase.org/db/get?name=WBStrain00054788

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00001595(gld-1)|WBGene00006751(unc-11)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00001595(gld-1), WBGene00006751(unc-11)
Availability: unknown
Source References: EMPTY
Synonyms: gld-1(q343)/unc-11(e47) dpy-5(e61) I
Notes: Heterozygotes are WT and segregate WT, Dpy Uncs, and homozygous q343 (make small abnormal oocytes. Pick WT and check for correct segregation of progeny to maintain. Reference: Francis R, et al. Genetics. 1995 Feb; 139(2): 579606. doi: 10.1093/genetics/139.2.579 PMID: 7713419.

Proper citation: RRID:WB-STRAIN:WBStrain00054788 Copy   


http://www.wormbase.org/db/get?name=WBStrain00062741

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00005077(src-1)|WBGene00006753(unc-14)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00005077(src-1), WBGene00006753(unc-14)
Availability: unknown
Source References: EMPTY
Synonyms: src-1(lq185)/tmC20 [unc-14(tmIs1219) dpy-5(tm9715)] I; juIs76 II.
Notes: juIs76 [unc-25p::GFP + lin-15(+)] II. Precise deletion of src-1 generated by Cas9 genome editing. Balancer marked with myo-2p::Venus. Heterozygotes are wild-type with Venus+ pharynx, and will segregate wild-type with Venus+ pharynx (heterozygotes), sterile adults without Venus in pharynx (lq185 homozygotes), and Dpy with Venus+ pharynx (tmC20 homozygotes). GFP expression in GABAergic motor neurons. Reference: Mahadik S, et al. bioRxiv 2023.05.20.541322; doi: https:

Proper citation: RRID:WB-STRAIN:WBStrain00062741 Copy   


http://www.wormbase.org/db/get?name=WBStrain00055739

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)
Genomic Alteration: WBGene00001067(dpy-5)
Availability: unknown
Source References: EMPTY
Synonyms: dpy-5(e61) I; fjDf1 fjDf2 fjDf3 fjDf4 X.
Notes: This strain carries a dpy-5 mutation to facilitate genome modification in CeRep55 quadruple deletion background: fjDf1 (also known as fj115); fjDf2 (aka fj85); fjDf3 (aka fj123); fjDf4 (aka fj120) X. This strain lacks four major clusters of CeRep55 repeats on the X chromosome. The condensation of unpaired X chromosomes in male testes is insufficient. CeRep55 is a class of minisatellite sequences consisting of a 27-nt tandem repeat that is present on all chromosomes. Some CeRep55 clusters express long non-coding RNAs and small RNAs. Each of the four deletion sites was designed to acquire a sequence tag (TGTACAGGAAACAGCTATGACC; similar to M13 reverse) instead of the CeRep55 tandem repeats. The deletions of CeRep55 clusters can be checked by PCR with the following primers: fjDf1 in Y73B3A, CAACCTGACTCTCGCCAAGAC and GGAGAAGTAGGCGTGTCAGTTA; fjDf2 in Y75D11A, CAAGTGCCAAACTAGACTGCTC and TTCAAAACGCTACGCGATACCAG; fjDf3 in Y81B9A, AAATGCCCCTATCTCACAGTGG and GACTGCTAGAATCTGACTCGTC; fjDf4 in Y49A10A, CAACCTGACTCTCGCCAAGAC and GGAGAAGTAGGCGTGTCAGTTA. The PCR check can also be performed with the M13 reverse primer and the right-side primer. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.|"This strain carries a dpy-5 mutation to facilitate genome modification in CeRep55 quadruple deletion background: fjDf1 (also known as fj115); fjDf2 (aka fj85); fjDf3 (aka fj123); fjDf4 (aka fj120) X. This strain lacks four major clusters of CeRep55 repeats on the X chromosome. The condensation of unpaired X chromosomes in male testes is insufficient. CeRep55 is a class of minisatellite sequences consisting of a 27-nt tandem repeat that is present on all chromosomes. Some CeRep55 clusters express long non-coding RNAs and small RNAs. Each of the four deletion sites was designed to acquire a sequence tag (TGTACAGGAAACAGCTATGACC; similar to M13 reverse) instead of the CeRep55 tandem repeats. The deletions of CeRep55 clusters can be checked by PCR with the following primers: fjDf1 in Y73B3A, CAACCTGACTCTCGCCAAGAC and GGAGAAGTAGGCGTGTCAGTTA; fjDf2 in Y75D11A, CAAGTGCCAAACTAGACTGCTC and TTCAAAACGCTACGCGATACCAG; fjDf3 in Y81B9A, AAATGCCCCTATCTCACAGTGG and GACTGCTAGAATCTGACTCGTC; fjDf4 in Y49A10A, CTCTTCCATTTCCAGTACAACCAG and GTTTCTATGGCTAGAGTCGTATGGTTAC. The PCR check can also be performed with the M13 reverse primer and the right-side primer. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002."

Proper citation: RRID:WB-STRAIN:WBStrain00055739 Copy   


  • RRID:WB-STRAIN:WBStrain00034126

http://www.wormbase.org/db/get?name=WBStrain00034126

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: dpy-5(e61) unc-54(e190) I.
Alternate IDs: WB-STRAIN:SP24, CGC_SP24
Notes: DpyUnc.

Proper citation: RRID:WB-STRAIN:WBStrain00034126 Copy   


  • RRID:WB-STRAIN:WBStrain00034439

http://www.wormbase.org/db/get?name=WBStrain00034439

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00003221(mes-3)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00003221(mes-3)
Availability: available
Source References: PMID:1783292
Synonyms: mes-3(bn35) dpy-5(e61) I; sDp2 (I;f).
Alternate IDs: WB-STRAIN:SS262, CGC_SS262
Notes: Animals with the Duplication have a WT phenotype. Animals which have lost the Duplication are Dpy and give sterile Dpy progeny. Strict maternal effect sterile. Sterile worms have a dramatic reduction in number of germs cells (10-100 fold less than WT). See also WBPaper00002343.

Proper citation: RRID:WB-STRAIN:WBStrain00034439 Copy   


  • RRID:WB-STRAIN:WBStrain00005501

http://www.wormbase.org/db/get?name=WBStrain00005501

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00006791(unc-57)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00006791(unc-57)
Availability: available
Source References: PMID:8462849
Synonyms: unc-57(ad592) dpy-5(e61) I.
Alternate IDs: WB-STRAIN:DA678, CGC_DA678
Notes: DpyUnc. ad592 is Eat. Dpy is semi-dominant.

Proper citation: RRID:WB-STRAIN:WBStrain00005501 Copy   


  • RRID:WB-STRAIN:WBStrain00005538

http://www.wormbase.org/db/get?name=WBStrain00005538

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00006765(unc-29)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00006765(unc-29)
Availability: available
Source References: PMID:8349107
Synonyms: hDf10 dpy-5(e61) unc-29(e403) I; sDp2 (I;f).
Alternate IDs: WB-STRAIN:DA1046, CGC_DA1046
Notes: Animals carrying sDp2 are Unc and segregate Unc and dead eggs.

Proper citation: RRID:WB-STRAIN:WBStrain00005538 Copy   


  • RRID:WB-STRAIN:WBStrain00006182

http://www.wormbase.org/db/get?name=WBStrain00006182

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00006790(unc-55)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00006790(unc-55)
Availability: available
Source References: EMPTY
Synonyms: dpy-5(e61) unc-55(e1170) I.
Alternate IDs: WB-STRAIN:DR101, CGC_DR101
Notes: Dpy. Unc. Closely Linked.

Proper citation: RRID:WB-STRAIN:WBStrain00006182 Copy   


  • RRID:WB-STRAIN:WBStrain00006203

http://www.wormbase.org/db/get?name=WBStrain00006203

Source Database: WormBase (WB)
Affected Genes: WBGene00000904(daf-8)|WBGene00001067(dpy-5)
Genomic Alteration: WBGene00000904(daf-8), WBGene00001067(dpy-5)
Availability: available
Source References: EMPTY
Synonyms: dpy-5(e61) daf-8(e1393) I.
Alternate IDs: WB-STRAIN:DR137, CGC_DR137
Notes: Temperature sensitive dauer constitutive. Dpy.

Proper citation: RRID:WB-STRAIN:WBStrain00006203 Copy   


  • RRID:WB-STRAIN:WBStrain00006233

http://www.wormbase.org/db/get?name=WBStrain00006233

Source Database: WormBase (WB)
Affected Genes: WBGene00000912(daf-16)|WBGene00001067(dpy-5)
Genomic Alteration: WBGene00000912(daf-16), WBGene00001067(dpy-5)
Availability: available
Source References: EMPTY
Synonyms: dpy-5(e61) daf-16(m27) I.
Alternate IDs: WB-STRAIN:DR234, CGC_DR234
Notes: Dauer defective. Dpy.|"Made_by: Albert P"

Proper citation: RRID:WB-STRAIN:WBStrain00006233 Copy   


  • RRID:WB-STRAIN:WBStrain00006226

http://www.wormbase.org/db/get?name=WBStrain00006226

Source Database: WormBase (WB)
Affected Genes: WBGene00000912(daf-16)|WBGene00001067(dpy-5)|WBGene00006807(unc-75)
Genomic Alteration: WBGene00000912(daf-16), WBGene00001067(dpy-5), WBGene00006807(unc-75)
Availability: available
Source References: EMPTY
Synonyms: dpy-5(e61) daf-16(m26) unc-75(e950) I.
Alternate IDs: WB-STRAIN:DR210, CGC_DR210
Notes: Dauer defective. Dpy. Unc. Leaky.

Proper citation: RRID:WB-STRAIN:WBStrain00006226 Copy   


  • RRID:WB-STRAIN:WBStrain00006247

http://www.wormbase.org/db/get?name=WBStrain00006247

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00006829(unc-101)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00006829(unc-101)
Availability: available
Source References: EMPTY
Synonyms: dpy-5(e61) unc-101(m1) I.
Alternate IDs: WB-STRAIN:DR293, CGC_DR293
Notes: Dpy. Unc-paralyzed coiler.|"Made_by: Golden J"

Proper citation: RRID:WB-STRAIN:WBStrain00006247 Copy   


  • RRID:WB-STRAIN:WBStrain00006264

http://www.wormbase.org/db/get?name=WBStrain00006264

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00006819(unc-87)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00006819(unc-87)
Availability: available
Source References: EMPTY
Synonyms: dpy-5(e61) unc-87(e1216) I.
Alternate IDs: WB-STRAIN:DR438, CGC_DR438
Notes: DpyUnc strain.

Proper citation: RRID:WB-STRAIN:WBStrain00006264 Copy   


  • RRID:WB-STRAIN:WBStrain00006263

http://www.wormbase.org/db/get?name=WBStrain00006263

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00006765(unc-29)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00006765(unc-29)
Availability: available
Source References: EMPTY
Synonyms: dpy-5(e61) unc-29(e1072) I.
Alternate IDs: WB-STRAIN:DR437, CGC_DR437
Notes: Dpy. Unc.

Proper citation: RRID:WB-STRAIN:WBStrain00006263 Copy   


  • RRID:WB-STRAIN:WBStrain00006262

http://www.wormbase.org/db/get?name=WBStrain00006262

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00006753(unc-14)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00006753(unc-14)
Availability: available
Source References: EMPTY
Synonyms: dpy-5(e61) unc-14(e57) I.
Alternate IDs: WB-STRAIN:DR436, CGC_DR436
Notes: Dpy. Unc.

Proper citation: RRID:WB-STRAIN:WBStrain00006262 Copy   


  • RRID:WB-STRAIN:WBStrain00022676

http://www.wormbase.org/db/get?name=WBStrain00022676

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00001250(elt-2)|WBGene00003056(lon-2)|WBGene00006752(unc-13)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00001250(elt-2), WBGene00003056(lon-2), WBGene00006752(unc-13)
Availability: available
Source References: PMID:9659934
Synonyms: dpy-5(e61) unc-13(e1091)/szT1 [lon-2(e678)] I; elt-2(ca15)/szT1 X.
Alternate IDs: WB-STRAIN:JM69, CGC_JM69
Notes: Heterozygotes are WT and segregate WT, Lon males and dead eggs.

Proper citation: RRID:WB-STRAIN:WBStrain00022676 Copy   


  • RRID:WB-STRAIN:WBStrain00023692

http://www.wormbase.org/db/get?name=WBStrain00023692

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00002612(let-392)|WBGene00006752(unc-13)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00002612(let-392), WBGene00006752(unc-13)
Availability: available
Source References: PMID:1603066
Synonyms: dpy-5(e61) let-392(h120) unc-13(e450) I; sDp2 (I;f).
Alternate IDs: WB-STRAIN:KR431, CGC_KR431
Notes: Animals with the Dup are Unc. Animals which have lost the Dup are DpyUncLet and arrest in early larval development. Maintain by picking Unc.

Proper citation: RRID:WB-STRAIN:WBStrain00023692 Copy   


  • RRID:WB-STRAIN:WBStrain00023699

http://www.wormbase.org/db/get?name=WBStrain00023699

Source Database: WormBase (WB)
Affected Genes: WBGene00000197(aars-2)|WBGene00001067(dpy-5)|WBGene00006752(unc-13)
Genomic Alteration: WBGene00000197(aars-2), WBGene00001067(dpy-5), WBGene00006752(unc-13)
Availability: available
Source References: PMID:2249758
Synonyms: aars-2(h112) dpy-5(e61) unc-13(e450) I; sDp2 (I;f).
Alternate IDs: WB-STRAIN:KR442, CGC_KR442
Notes: Unc-13 phenotype. Segregates Uncs and lethal DpyUncs (h112 arrests as a mid-stage larva). Maintain by picking Unc-13 and checking for correct segregation of progeny.

Proper citation: RRID:WB-STRAIN:WBStrain00023699 Copy   


  • RRID:WB-STRAIN:WBStrain00023696

http://www.wormbase.org/db/get?name=WBStrain00023696

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00003132(mat-1)|WBGene00006752(unc-13)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00003132(mat-1), WBGene00006752(unc-13)
Availability: available
Source References: WBPaper00000975(PMID:EMPTY)
Synonyms: mat-1(h104) dpy-5(e61) unc-13(e450) I; sDp2 (I;f).
Alternate IDs: WB-STRAIN:KR435, CGC_KR435
Notes: Unc-13 phenotype. Segregates Uncs and lethal DpyUncs (h104 arrests as a sterile adult). Maintain by picking Unc-13 and checking for correct segregation of progeny.

Proper citation: RRID:WB-STRAIN:WBStrain00023696 Copy   


  • RRID:WB-STRAIN:WBStrain00023697

http://www.wormbase.org/db/get?name=WBStrain00023697

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00002592(let-372)|WBGene00006752(unc-13)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00002592(let-372), WBGene00006752(unc-13)
Availability: available
Source References: WBPaper00000975(PMID:EMPTY)
Synonyms: let-372(h126) dpy-5(e61) unc-13(e450) I; sDp2 (I;f).
Alternate IDs: WB-STRAIN:KR436, CGC_KR436
Notes: Unc-13 phenotype. Segregates Uncs and lethal DpyUncs (h126 arrests as a sterile adult). Maintain by picking Unc-13 and checking for correct segregation of progeny.

Proper citation: RRID:WB-STRAIN:WBStrain00023697 Copy   



Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
  1. Type 1 Diabetes Research Networks Resources

    Welcome to the T1D Resources search. From here you can search through a compilation of resources used by T1D and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that T1D has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on T1D then you can log in from here to get additional features in T1D such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into T1D you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within T1D that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X