Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Background:mutant (facet)

Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

1,464 Results - per page

Show More Columns | Download Top 1000 Results

Organism Name Proper Citation Species Synonyms Notes Phenotype Affected Gene Genomic Alteration Catalog Number Background Database Database Abbreviation Availability Source References Alternate IDs Record Last Update Mentions Count
LE-Lrrk1em1Sage
 
Resource Report
Resource Website
RRID:RGD_7241051 Rattus norvegicus This strain was produced by injecting ZFNs into Crl:LE rat embryos. The resulting mutation is a 19-bp frameshift deletion in exon 4. Horizon Discovery 7241051 mutant Rat Genome Database (RGD) RGD Unknown 7241051 2026-09-05 06:52:32 0
W-LeprfaNin
 
Resource Report
Resource Website
RRID:RGD_8655992 Rattus norvegicus The spontaneously developed obese rat was derived from the colony of inbred W/Nin by selective breeding. Its lean litter mate ( W-Lepr+/+/Nin, RGD:8655977) was used as a control strain in obesity related study. 8655992 mutant Rat Genome Database (RGD) RGD Unknown 8655992 2026-09-05 06:52:32 0
SS-Apoeem9Mcwi
 
Resource Report
Resource Website
RRID:RGD_7364879 Rattus norvegicus This strain was produced by injecting ZFNs targeting the sequence CAGGCCCTGAACCGCttctggGATTACCTGCGCTGGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 101-bp deletion in exon 2 and intron 3 7364879 mutant Rat Genome Database (RGD) RGD Cryopreserved Sperm (as of 2017-01-26) 7364879 2026-09-05 06:52:33 0
SD-Rag1em1Ang
 
Resource Report
Resource Website
RRID:RGD_7204136 Rattus norvegicus This strain was produced by injecting ZFNs into Sprague-Dawley rat embryos. The resulting mutation is a 5-bp frameshift deletion in the Rag1 gene that predicts a protein with a normal sequence up to aa 245, followed by 5 aa from the insertions and mutations, followed by a stop codon in position 751. 7204136 mutant Rat Genome Database (RGD) RGD Unknown 7204136 2026-09-05 06:52:32 0
F344-Sv2am1Kyo
 
Resource Report
Resource Website
RRID:RGD_7800671 Rattus norvegicus Established by ENU mutagenesis. A missense mutation (L174Q) mutation in Sv2a: synaptic vesicle glycoprotein 2a, was identified. National BioResource Project for the Rat in Japan 7800671 mutant Rat Genome Database (RGD) RGD Unknown 7800671 2026-09-05 06:52:33 0
KFRS2/Kyo-/+
 
Resource Report
Resource Website
RRID:RGD_7800673 Rattus norvegicus A male rat "SRR-Do Your Best" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "SRR-Do Your Best" and a female PVG/Seac. National BioResource Project for the Rat in Japan 7800673 mutant Rat Genome Database (RGD) RGD Live Animals; Cryopreserved Sperm 7800673 2026-09-05 06:52:33 0
F344.Cg-Foxn1rnuKyo-/+
 
Resource Report
Resource Website
RRID:RGD_7800667 Rattus norvegicus Jic N13 to Kyo (1988) National BioResource Project for the Rat in Japan 7800667 mutant Rat Genome Database (RGD) RGD Live Animals; Cryopreserved Sperm 7800667 2026-09-05 06:52:34 0
TM-Il2rgem5Kyo
 
Resource Report
Resource Website
RRID:RGD_9685754 Rattus norvegicus This strain shows severe combined immunodeficiency caused by a zinc finger nuclease induced 653-bp deletion in Il2rg gene of TM/Kyo embryo. The rats grow normally under SPF condition. National BioResource Project for the Rat in Japan 9685754 mutant Rat Genome Database (RGD) RGD Unknown 9685754 2026-09-05 06:52:33 0
TM-Il2rgem4Kyo
 
Resource Report
Resource Website
RRID:RGD_9685752 Rattus norvegicus The severe combined immunodeficiency strain carries a zinc finger nuclease-induced 162-bp deletion mutation in rat Il2rg gene. Grows normally under SPF condition. National BioResource Project for the Rat in Japan 9685752 mutant Rat Genome Database (RGD) RGD Unknown 9685752 2026-09-05 06:52:33 0
SS.BN-(D13Rat25-rs106935835)-Btg2em7Mcwi
 
Resource Report
Resource Website
RRID:RGD_10054307 Rattus norvegicus The Btg2 mutant rats were generated using transcription activator-like effector nuclease (TALEN) constructs specific for the rat Btg2 gene designed to target exon 1 using the target sequence TAGGTTTCCTCACCAGTCtcctgaggactcggggcTGCGTGAGCGAGCAGAGA. The result was a 44-bp deletion mutation in exon 1 (RNO13:50,916,769-50,916,812; aaaccttgagtctctgctcgctcacgcagccccgagtcctcagg) of SS.BN-(D13Rat25-rs106935835)/Mcwi rat embryos. Contact MCW rat distribution at [email protected] 10054307 mutant Rat Genome Database (RGD) RGD Live Animals; Cryopreserved Sperm (as of 2021-11-03) 10054307 2026-09-05 06:52:35 0
LEW-Pkd1em3Mcwi
 
Resource Report
Resource Website
RRID:RGD_10054433 Rattus norvegicus CRISPR/Cas9 system was used to introduce a mutation in the Pkd1 gene of LEW/NCrl rat embryos. The resulting mutation is a 12-bp deletion in the Pkd1 gene. Contact MCW rat distribution at [email protected] 10054433 mutant Rat Genome Database (RGD) RGD Cryopreserved Sperm (as of 2018-10-22) 10054433 2026-09-05 06:52:35 0
SD-Drd1em1Ionsz
 
Resource Report
Resource Website
RRID:RGD_11073719 Rattus norvegicus CRISPR/Cas9 system was used to generate this mutant; sgRNA+Cas9+ plasmid was injected into zygote of SD rat that added a 2A-Chr2-EYFP behind the stop codon of Drd1. Institute of Neuroscience, Chinese Academy of Sciences 11073719 mutant Rat Genome Database (RGD) RGD Unknown 11073719 2026-09-05 06:52:35 0
SD-Abcc6em4Qlju-/-
 
Resource Report
Resource Website
RRID:RGD_10413856 Rattus norvegicus This strain was produced by injecting ZFNs into SD embryos. ZFNs were designed to target exon 1 of rat Abcc6 gene at the binding site/cutting site 5-CACGCCTGGAGAGTCCTGcgcaggCCTGAGGGTGAGTCC-3 (c.24-c.62). The resulting mutation is a 20-bp deletion from cDNA position 30-49 (GAGAGTCCTGCGCAGGCCTG). The mutation is predicted to cause out of frame translation and a premature stop codon. No protein in the homozygous mutant was detected by immunostaining. 10413856 mutant Rat Genome Database (RGD) RGD Unknown 10413856 2026-09-05 06:52:35 0
SD-Gfapem1(2A-Chr2-EYFP)Ionsz
 
Resource Report
Resource Website
1+ mentions
RRID:RGD_10054279 Rattus norvegicus CRISPR/Cas9 system was used to generate this mutant; sgRNA+Cas9+ plasmid was injected into zygote of SD rat that added a 2A ( the self-cleaving 2A peptide sequence from foot-and-mouth disease virus or other picornaviruses), blue light-gated cation channel channelrhodopsin-2 (ChR2) and EYFP behind the last exon of Gfap. Institute of Neuroscience, Chinese Academy of Sciences 10054279 mutant Rat Genome Database (RGD) RGD Unknown 10054279 2026-09-05 06:52:35 2
SD-Vcpem1Ionsz
 
Resource Report
Resource Website
RRID:RGD_10054276 Rattus norvegicus CRISPR/Cas9 system was used to generate this mutant; sgRNA+Cas9+Oligo was injected into zygote of SD rat that made the 155th amino acid Arg into His 10054276 mutant Rat Genome Database (RGD) RGD Unknown 10054276 2026-09-05 06:52:35 0
SD-Lepem1Narl
 
Resource Report
Resource Website
RRID:RGD_10401851 Rattus norvegicus CRISPR/Cas9 system was used to generate this mutant. This mutant strain has increased body weight, increased circulating cholesterol level and increased triglyceride level compared to its littermates 10401851 mutant Rat Genome Database (RGD) RGD Unknown 10401851 2026-09-05 06:52:35 0
SHR-Ndufc2em2Mcwi-/+
 
Resource Report
Resource Website
RRID:RGD_11040521 Rattus norvegicus ZFN mutant founders were backcrossed with SHR/NCrl to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 11040521 mutant Rat Genome Database (RGD) RGD Unknown 11040521 2026-09-05 06:52:35 0
iNP-Npyem6Sage/Iusm
 
Resource Report
Resource Website
RRID:RGD_11530028 Rattus norvegicus These ZFN mutant rats were produced by injecting zinc finger nuclease targeting rat Npy into iNP/Iusm embryos. A 26-bp deletion, including 6 bp in intron 1 and 20 bp in exon 2 in rat Npy was created in the mutant founders. These mutant founders were backcrossed with iNP/Iusm to produce heterozygous offspring, which were then intercrossed to produce homozygous and heterozygous offspring. 11530028 mutant Rat Genome Database (RGD) RGD Unknown 11530028 2026-09-05 06:52:35 0
SS-Adora1em4Mcwi
 
Resource Report
Resource Website
RRID:RGD_10054284 Rattus norvegicus CRISPR/Cas9 system was used to introduce a mutation in the Adora1 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 34-bp deletion in the Adora1 gene. Contact MCW rat distribution at [email protected] 10054284 mutant Rat Genome Database (RGD) RGD Cryopreserved Sperm (as of 2018-10-22) 10054284 2026-09-05 06:52:34 0
SD-Crhem1Ionsz
 
Resource Report
Resource Website
RRID:RGD_11049145 Rattus norvegicus CRISPR/Cas9 system was used to generate this mutant; sgRNA+Cas9+ plasmid was injected into zygote of SD rat that added a GFP-Cre-2A behind the last exon of Crh. 11049145 mutant Rat Genome Database (RGD) RGD Unknown 11049145 2026-09-05 06:52:34 0

Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
X
  1. Type 1 Diabetes Research Networks Resources

    Welcome to the T1D Resources search. From here you can search through a compilation of resources used by T1D and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that T1D has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on T1D then you can log in from here to get additional features in T1D such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into T1D you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.