Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Search

Type in a keyword to search
Reset search
On page 31 showing 601 ~ 620 out of 64,152 results
Snippet view Table view Download Top 1000 Results

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

http://www.wormbase.org/db/get?name=WBStrain00063163

Source Database: WormBase (WB)
Affected Genes: WBGene00001597(gld-3)
Genomic Alteration: WBGene00001597(gld-3)
Availability: unknown
Source References: EMPTY
Synonyms: gld-3(ust495[gld-3::GFP::3xFlag]) II.
Notes: GFP::3xFlag inserted into endogenous gld-3 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans.|"Made_by: Xiaona Huang"

Proper citation: RRID:WB-STRAIN:WBStrain00063163 Copy   

http://www.wormbase.org/db/get?name=WBStrain00063166

Source Database: WormBase (WB)
Affected Genes: WBGene00003993(pgl-2)
Genomic Alteration: WBGene00003993(pgl-2)
Availability: unknown
Source References: EMPTY
Synonyms: pgl-2(ust515[3xFlag::GFP::pgl-2]) III.
Notes: 3xFlag::GFP inserted into endogenous pgl-2 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans.|"Made_by: Xiaona Huang"

Proper citation: RRID:WB-STRAIN:WBStrain00063166 Copy   

http://www.wormbase.org/db/get?name=WBStrain00063167

Source Database: WormBase (WB)
Affected Genes: WBGene00021014(pid-4)
Genomic Alteration: WBGene00021014(pid-4)
Availability: unknown
Source References: EMPTY
Synonyms: pid-4(ust516[pid-4::GFP::3xFlag]) I.
Notes: GFP::3xFlag inserted into endogenous pid-4 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans.|"Made_by: Xiaona Huang"

Proper citation: RRID:WB-STRAIN:WBStrain00063167 Copy   

http://www.wormbase.org/db/get?name=WBStrain00063168

Source Database: WormBase (WB)
Affected Genes: WBGene00021555(pid-5)
Genomic Alteration: WBGene00021555(pid-5)
Availability: unknown
Source References: EMPTY
Synonyms: pid-5(ust517[pid-5::GFP::3xFlag]) V.
Notes: GFP::3xFlag inserted into endogenous pid-5 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans.|"Made_by: Xiaona Huang"

Proper citation: RRID:WB-STRAIN:WBStrain00063168 Copy   

http://www.wormbase.org/db/get?name=WBStrain00063208

Source Database: WormBase (WB)
Affected Genes: WBGene00001978(hmp-1)
Genomic Alteration: WBGene00001978(hmp-1)
Availability: unknown
Source References: EMPTY
Synonyms: hmp-1(jc58[hmp-1::mScarlet-1 + Lox511]) V.
Notes: Made_by: Joel M. Serre|"mScarlet tag inserted into endogenous hmp-1 locus by CRISPR/Cas9 genome editing. Reference: Serre JM, et al. PLoS Genet. 2023 Mar 3;19(3):e1010507. doi: 10.1371/journal.pgen.1010507. PMID: 36867663."

Proper citation: RRID:WB-STRAIN:WBStrain00063208 Copy   

    • RRID:WB-STRAIN:WBStrain00063205

http://www.wormbase.org/db/get?name=WBStrain00063205

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: zjuEx2429.
Notes: Made_by: Jingxiu Xu|"zjuEx2429 [col-19p::BFP::8xMS2 + semo-1p::MCP::24Suntag + col-19p::scFv::sfGFP + myo-2p::GFP]. Pick GFP+ (pharynx) animals to maintain. MS2-based signal Amplification with Suntag System (MASS). Enhanced MS2-based single-molecule RNA imaging system utilizes Suntag signal amplifier. Suntag is a 19 amino acid protein tag that binds to its specific single-chain variable fragment (scFv) antibody. When all the required elements of the MASS (MS2, MCP, 24xSuntag, and scFv antibodies) are present, bright GFP foci will mark the tagged RNA. Reference: Hu Y, et al. eLife. 2023 Mar 3;12:e82178. doi: 10.7554/eLife.82178. PMID: 36867026."

Proper citation: RRID:WB-STRAIN:WBStrain00063205 Copy   

http://www.wormbase.org/db/get?name=WBStrain00063151

Source Database: WormBase (WB)
Affected Genes: WBGene00004984(spn-4)
Genomic Alteration: WBGene00004984(spn-4)
Availability: unknown
Source References: EMPTY
Synonyms: spn-4(ust434[spn-4::GFP::3xFlag]) V.
Notes: GFP::3xFlag inserted into endogenous spn-4 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans.|"Made_by: Xiaona Huang"

Proper citation: RRID:WB-STRAIN:WBStrain00063151 Copy   

http://www.wormbase.org/db/get?name=WBStrain00063150

Source Database: WormBase (WB)
Affected Genes: WBGene00008061(mina-1)
Genomic Alteration: WBGene00008061(mina-1)
Availability: unknown
Source References: EMPTY
Synonyms: mina-1(ust433[mina-1::GFP::3xFlag]) I.
Notes: GFP::3xFlag inserted into endogenous mina-1 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans.|"Made_by: Xiaona Huang"

Proper citation: RRID:WB-STRAIN:WBStrain00063150 Copy   

http://www.wormbase.org/db/get?name=WBStrain00063155

Source Database: WormBase (WB)
Affected Genes: WBGene00001595(gld-1)
Genomic Alteration: WBGene00001595(gld-1)
Availability: unknown
Source References: EMPTY
Synonyms: gld-1(ust451[gld-1::GFP::3xFlag]) I.
Notes: GFP::3xFlag inserted into endogenous gld-1 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans.|"Made_by: Xiaona Huang"

Proper citation: RRID:WB-STRAIN:WBStrain00063155 Copy   

http://www.wormbase.org/db/get?name=WBStrain00063154

Source Database: WormBase (WB)
Affected Genes: WBGene00010281(mip-2)
Genomic Alteration: WBGene00010281(mip-2)
Availability: unknown
Source References: EMPTY
Synonyms: mip-2(ust450[mip-2::GFP::3xFlag]) V.
Notes: GFP::3xFlag inserted into endogenous mip-2 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans.|"Made_by: Xiaona Huang"

Proper citation: RRID:WB-STRAIN:WBStrain00063154 Copy   

http://www.wormbase.org/db/get?name=WBStrain00063159

Source Database: WormBase (WB)
Affected Genes: WBGene00001601(glh-4)
Genomic Alteration: WBGene00001601(glh-4)
Availability: unknown
Source References: EMPTY
Synonyms: glh-4(ust449[glh-4::GFP::3xFlag]) I.
Notes: GFP::3xFlag inserted into endogenous glh-4 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans.|"Made_by: Xiaona Huang"

Proper citation: RRID:WB-STRAIN:WBStrain00063159 Copy   

http://www.wormbase.org/db/get?name=WBStrain00063140

Source Database: WormBase (WB)
Affected Genes: WBGene00011580(ddx-19)
Genomic Alteration: WBGene00011580(ddx-19)
Availability: unknown
Source References: EMPTY
Synonyms: ddx-19(ust374[ddx-19::mCherry]) II.
Notes: mCherry inserted into endogenous ddx-19 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans.

Proper citation: RRID:WB-STRAIN:WBStrain00063140 Copy   

http://www.wormbase.org/db/get?name=WBStrain00063148

Source Database: WormBase (WB)
Affected Genes: WBGene00015349(henn-1)
Genomic Alteration: WBGene00015349(henn-1)
Availability: unknown
Source References: EMPTY
Synonyms: henn-1(ust413[henn-1::GFP::3xFlag]) III.
Notes: GFP::3xFlag inserted into endogenous henn-1 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans.|"Made_by: Xiaona Huang"

Proper citation: RRID:WB-STRAIN:WBStrain00063148 Copy   

http://www.wormbase.org/db/get?name=WBStrain00063298

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006745(unc-5)|WBGene00006789(unc-54)|WBGene00015551(adah-1)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006745(unc-5), WBGene00006789(unc-54), WBGene00015551(adah-1)
Availability: unknown
Source References: EMPTY
Synonyms: adah-1(hd7105 [loxP + myo-2p::GFP::unc-54 3 UTR + rps-27p::neoR::unc-54 3 UTR + loxP])/tmC25 [unc-5(tm9708)] IV.
Notes: Made_by: VH KO group|"Maintain by picking wild-type GFP+. Apparent homozygous lethal or sterile deletion balanced tmC25. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+ and Unc animals (tmC25 [unc-5(tm9708)] homozygotes). Derived from parental strains VH7105 and FX30257. hd7105 is a deletion of 4581 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."

Proper citation: RRID:WB-STRAIN:WBStrain00063298 Copy   

http://www.wormbase.org/db/get?name=WBStrain00063331

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: F56B3.6(hd7168[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV.
Notes: Homozygous viable. Deletion of 2190 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TCAACTTCTGGACAACCGGCAGAAACGCCA; Right flanking sequence: GTAGGCACAAAGAAGGCGTAGGCCTCCTGG. sgRNA #1: TGGCGTTTCAGAGCTGCACG; sgRNA #2: AAAGCCAATTGTCTGAAAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: VH KO group"

Proper citation: RRID:WB-STRAIN:WBStrain00063331 Copy   

http://www.wormbase.org/db/get?name=WBStrain00063332

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00018491(mdh-1)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00018491(mdh-1)
Availability: unknown
Source References: EMPTY
Synonyms: mdh-1(hd7169[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V.
Notes: Homozygous viable. Deletion of 969 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTAAGACCTTGAACAATCTTCCATTCGCCA; Right flanking sequence: CGGACATTCTGAAAATTTAGCAATTTACAC. sgRNA #1: TTCCCAGTTACCATCGAGGG; sgRNA #2: GACCAAAACGCGAAGTGGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: VH KO group"

Proper citation: RRID:WB-STRAIN:WBStrain00063332 Copy   

http://www.wormbase.org/db/get?name=WBStrain00063297

Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00000254(bli-4), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: F46F11.10(hd7096 [loxP + myo-2p::GFP::unc-54 3 UTR + rps-27p::neoR::unc-54 3 UTR + loxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III.
Notes: Made_by: VH KO group|"umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged hT2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (hd7096 homozygotes), lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VH7096 and CGC92. hd7096 is a 667 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."

Proper citation: RRID:WB-STRAIN:WBStrain00063297 Copy   

http://www.wormbase.org/db/get?name=WBStrain00063335

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00020718(mrps-2)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00020718(mrps-2)
Availability: unknown
Source References: EMPTY
Synonyms: +/nT1 [umnls49] IV; mrps-2 (hd7170 [loxP + myo-2p::GFP::unc-54 3 UTR + rps-27p::neoR::unc-54 3 UTR + loxP])/nT1 V
Notes: Made_by: VH KO group|"umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over nT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, Vul mKate2+ (nT1) and dead eggs. Derived from parental strains VH7170 and CGC63. hd7170 is a 966 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: CAGAAAGAGCCTTCTCGACACGATTTTCCG; Right flanking sequence: TTCGAAAGTGGCAATCAGGAACTCTAACGA. sgRNA #1: AATGGTTACCTGCTGCGACG; sgRNA #2: GGTTGGGCAATACTCTCACG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."

Proper citation: RRID:WB-STRAIN:WBStrain00063335 Copy   

http://www.wormbase.org/db/get?name=WBStrain00063336

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00022152(atg-5)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00022152(atg-5)
Availability: unknown
Source References: EMPTY
Synonyms: atg-5(hd7174[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I.
Notes: Homozygous viable. Deletion of 6488 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTAAAGCCGAGATTACAAAGAATATGATGA; Right flanking sequence: GACCTTTTATAACTATTCACCCATACTAAT. sgRNA #1: AAGACGAGTCGGCACAGTTG; sgRNA #2: GTGAAGTTGTTATTGTACGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: VH KO group"

Proper citation: RRID:WB-STRAIN:WBStrain00063336 Copy   

http://www.wormbase.org/db/get?name=WBStrain00063333

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: cyp-33C8(hd7171[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V.
Notes: Homozygous viable. Deletion of 2415 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAACTTTCTCGGAGTTATCCCCTTCGATTT; Right flanking sequence: GGGAGAGGAGTAGGTCCCGGTGGTAAATTT. sgRNA #1: GTCGAGCGATGGAAGACCGG; sgRNA #2: GGAGAGTATTGCCGAACAGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: VH KO group"

Proper citation: RRID:WB-STRAIN:WBStrain00063333 Copy   

Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X

  1. Type 1 Diabetes Research Networks Resources

    Welcome to the T1D Resources search. From here you can search through a compilation of resources used by T1D and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that T1D has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on T1D then you can log in from here to get additional features in T1D such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into T1D you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within T1D that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X

About

Understanding Type 1 Diabetes Research Networks

Recent News Entries

Contact Us

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch