Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00063130
Source Database: WormBase (WB)
Affected Genes: WBGene00002275(lem-2)
Genomic Alteration: WBGene00002275(lem-2)
Availability: unknown
Source References: EMPTY
Synonyms: lem-2(sbw5[lem-2::mNeonGreen]) II.
Notes: Made_by: Sarah Barger|"mNeonGreen tag inserted at C-terminus of endogenous lem-2 locus using self-exising drug selection casette method (described by Hastie et al., 2019 J Microbiol Biol Educ). Reference: Barger SR, et al. J Cell Sci 1 November 2023; 136 (21): jcs261385. doi: https:"
Proper citation: RRID:WB-STRAIN:WBStrain00063130 Copy
http://www.wormbase.org/db/get?name=WBStrain00063094
Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00004267(rab-3)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00004267(rab-3)
Availability: unknown
Source References: EMPTY
Synonyms: dpy-10(cn64) rab-3(ftw79) II.
Notes: rab-3(ftw79[rab-3::SL2::LoxP::GFP::NLS::3'UTR::Abeta(inv)::sigPep(inv)::T2A(inv)::wrmScarlet11(inv)::LoxP(inv)]) II. Modified endogenous rab-3 locus co-expresses stochastic, switchable cassette by trans-splicing using CRISPR-Cas9. Green fluorescence visible in neurons by dissection fluorescence microscopy. Inverted LoxP sites flank the GFP-NLS and inverted wrmScarlet11::T2A::signalPeptide::Abeta insert. Please contact Ryan Littlefield prior to publishing work using this strain.
Proper citation: RRID:WB-STRAIN:WBStrain00063094 Copy
http://www.wormbase.org/db/get?name=WBStrain00063095
Source Database: WormBase (WB)
Affected Genes: WBGene00003370(mlc-2)
Genomic Alteration: WBGene00003370(mlc-2)
Availability: unknown
Source References: EMPTY
Synonyms: mlc-2(ftw80[LifeAct::wrmScarlet::SL2::mlc-2]) X.
Notes: Endogenous mlc-2 locus co-expresses LifeAct peptide fused to wrmScarlet. Myosin light chain is untagged. Bright red fluorescence in all muscles is visible by dissection fluorescence microscopy. Broad bands of fluorescence are visible in body wall muscle by confocal microscopy. Please contact Ryan Littlefield prior to publishing work with this strain.
Proper citation: RRID:WB-STRAIN:WBStrain00063095 Copy
http://www.wormbase.org/db/get?name=WBStrain00063133
Source Database: WormBase (WB)
Affected Genes: WBGene00002275(lem-2)
Genomic Alteration: WBGene00002275(lem-2)
Availability: unknown
Source References: EMPTY
Synonyms: lem-2(sbw20) II.
Notes: CRISPR/Cas9-engineered deletion of entire lem-2 locus. Reference: Barger SR, et al. J Cell Sci 1 November 2023; 136 (21): jcs261385. doi: https:|"Made_by: Sarah Barger"
Proper citation: RRID:WB-STRAIN:WBStrain00063133 Copy
http://www.wormbase.org/db/get?name=WBStrain00063134
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: ustSi268 I.
Notes: ustSi268 [mex-5p::tagrfp::elli-1::tbb-2 3'UTR] I. Inserted into LG I (-5.51 cM) locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans. Reference: Chen X, et al. Nat Commun. 2024 Jul 10;15(1):5799. doi: 10.1038/s41467-024-50027-3. PMID: 38987544.
Proper citation: RRID:WB-STRAIN:WBStrain00063134 Copy
http://www.wormbase.org/db/get?name=WBStrain00063131
Source Database: WormBase (WB)
Affected Genes: WBGene00000235(baf-1)
Genomic Alteration: WBGene00000235(baf-1)
Availability: unknown
Source References: EMPTY
Synonyms: baf-1(sbw7[mNeonGreen::baf-1]) III.
Notes: Made_by: Sarah Barger|"mNeonGreen tag inserted at N-terminus of endogenous baf-1 locus using self-excising drug selection cassette method (described by Dickinson, et al. 2015, Genetics). Reference: Barger SR, et al. J Cell Sci 1 November 2023; 136 (21): jcs261385. doi: https:"
Proper citation: RRID:WB-STRAIN:WBStrain00063131 Copy
http://www.wormbase.org/db/get?name=WBStrain00063099
Source Database: WormBase (WB)
Affected Genes: WBGene00006585(tni-3)
Genomic Alteration: WBGene00006585(tni-3)
Availability: unknown
Source References: EMPTY
Synonyms: tni-3(ftw13[tni-3::mCherry::SL2::GFP::NLS]) V.
Notes: Endogenous tni-3 locus tagged with mCherry using CRISPR/Cas9. GFP-nls coexpressed from the endogenous promoter using SL2 trans-splicing. Visible using fluorescent dissecting microscopes. WT movement and behavior. Please contact Ryan Littlefield prior to publishing work using this strain.|"Made_by: Ryan Littlefield & Tammie Ward"
Proper citation: RRID:WB-STRAIN:WBStrain00063099 Copy
http://www.wormbase.org/db/get?name=WBStrain00063138
Source Database: WormBase (WB)
Affected Genes: WBGene00001402(fbf-2)
Genomic Alteration: WBGene00001402(fbf-2)
Availability: unknown
Source References: EMPTY
Synonyms: fbf-2(ust337[fbf-2::GFP::3xFlag]) II.
Notes: GFP::3xFlag inserted into endogenous fbf-2 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans.|"Made_by: Xiaona Huang"
Proper citation: RRID:WB-STRAIN:WBStrain00063138 Copy
http://www.wormbase.org/db/get?name=WBStrain00063086
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: ZK1240.6(ve999[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II.
Notes: Homozygous viable. Deletion of 398 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TCCTGAAAATTAATATTAGGTACCTGACCT ; Right flanking sequence: ACTTGGAAATTGGAGAGCAAGTAAAAGTTA. ZK1240.6 sgRNA A: ACTTCAGAACCTGATATGCA; ZK1240.6 sgRNA B: TAGTCGAGTTATTCGTGCAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00063086 Copy
http://www.wormbase.org/db/get?name=WBStrain00063083
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: Y25C1A.8(ve996[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II.
Notes: Homozygous viable. Deletion of 3675 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CACTTTCTGGGCAAGAGCATTCACCGCCCG ; Right flanking sequence: CGGTTTCGCTGAAAATCGATAATTTTTGGG. Y25C1A.8 sgRNA A: CAGATGCTCATGCTCATGCT; Y25C1A.8 sgRNA B: CCAATTTTGCTTTTCGCGCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00063083 Copy
http://www.wormbase.org/db/get?name=WBStrain00063122
Source Database: WormBase (WB)
Affected Genes: WBGene00006538(tbb-4)
Genomic Alteration: WBGene00006538(tbb-4)
Availability: unknown
Source References: EMPTY
Synonyms: tbb-4(tj74[gfp::TEV::3xFLAG::tbb-4]) X.
Notes: GFP::TEV::3xFLAG tag inserted into the endogenous tbb-4 locus. Reference: Nishida K, et al. Cell Struct. Funct. 2021 Jun 30;46(1):51-64. PMID: 33967119.
Proper citation: RRID:WB-STRAIN:WBStrain00063122 Copy
http://www.wormbase.org/db/get?name=WBStrain00063123
Source Database: WormBase (WB)
Affected Genes: WBGene00003171(mec-7)
Genomic Alteration: WBGene00003171(mec-7)
Availability: unknown
Source References: EMPTY
Synonyms: mec-7(tj77[gfp::TEV::3xFLAG::mec-7]) X.
Notes: GFP::TEV::3xFLAG tag inserted into the endogenous mec-7 locus. Reference: Nishida K, et al. Cell Struct. Funct. 2021 Jun 30;46(1):51-64. PMID: 33967119.
Proper citation: RRID:WB-STRAIN:WBStrain00063123 Copy
http://www.wormbase.org/db/get?name=WBStrain00063120
Source Database: WormBase (WB)
Affected Genes: WBGene00006533(tba-7)
Genomic Alteration: WBGene00006533(tba-7)
Availability: unknown
Source References: EMPTY
Synonyms: tba-7(tj66[gfp::TEV::3xFLAG::tba-7]) III.
Notes: GFP::TEV::3xFLAG tag inserted into the endogenous tba-7 locus. Reference: Nishida K, et al. Cell Struct. Funct. 2021 Jun 30;46(1):51-64. PMID: 33967119.|"Made_by: Hiroyuki Obinata"
Proper citation: RRID:WB-STRAIN:WBStrain00063120 Copy
http://www.wormbase.org/db/get?name=WBStrain00063126
Source Database: WormBase (WB)
Affected Genes: WBGene00006531(tba-5)
Genomic Alteration: WBGene00006531(tba-5)
Availability: unknown
Source References: EMPTY
Synonyms: tba-5(tj102[gfp::TEV::3xFLAG::tba-5]) I.
Notes: GFP::TEV::3xFLAG tag inserted into the endogenous tba-5 locus. Reference: Nishida K, et al. Cell Struct. Funct. 2021 Jun 30;46(1):51-64. PMID: 33967119.|"Made_by: Shizuka Onodera"
Proper citation: RRID:WB-STRAIN:WBStrain00063126 Copy
http://www.wormbase.org/db/get?name=WBStrain00063125
Source Database: WormBase (WB)
Affected Genes: WBGene00006535(tba-9)
Genomic Alteration: WBGene00006535(tba-9)
Availability: unknown
Source References: EMPTY
Synonyms: tba-9(tj100[gfp::TEV::3xFLAG::tba-9]) X.
Notes: GFP::TEV::3xFLAG tag inserted into the endogenous tba-9 locus. Reference: Nishida K, et al. Cell Struct. Funct. 2021 Jun 30;46(1):51-64. PMID: 33967119.|"Made_by: Hiroyuki Obinata"
Proper citation: RRID:WB-STRAIN:WBStrain00063125 Copy
http://www.wormbase.org/db/get?name=WBStrain00063195
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: ustSi64 II.
Notes: ustSi64 [wago-3p::3xFlag::GFP::wago-3::wago-3 3'UTR + Cbr-unc-119(+)] II. Inserted into ttTi5605 of parental strain EG4322. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans.
Proper citation: RRID:WB-STRAIN:WBStrain00063195 Copy
http://www.wormbase.org/db/get?name=WBStrain00063199
Source Database: WormBase (WB)
Affected Genes: WBGene00002061(ife-3)
Genomic Alteration: WBGene00002061(ife-3)
Availability: unknown
Source References: EMPTY
Synonyms: ife-3(ust639[ife-3::GFP::3xFlag]) V.
Notes: GFP::3xFlag inserted into endogenous ife-3 locus using CRISPR/CAS9 engineering. Reference: Zeng C, et al. Cell Rep. 2019 Jun 18;27(12):3561-3572.e3. doi: 10.1016/j.celrep.2019.05.076. PMID: 31216475.|"Made_by: Chenmimg Zeng"
Proper citation: RRID:WB-STRAIN:WBStrain00063199 Copy
http://www.wormbase.org/db/get?name=WBStrain00063237
Source Database: WormBase (WB)
Affected Genes: WBGene00006364(syd-2)|WBGene00006750(unc-10)
Genomic Alteration: WBGene00006364(syd-2), WBGene00006750(unc-10)
Availability: unknown
Source References: EMPTY
Synonyms: wyIs891 III; unc-10(wy1235[unc-10::FLPon::mScarlet-I]) syd-2(wy1323) X.
Notes: Made_by: Nathan McDonald|"wyIs891 [unc-86p::FLP + odr-1p::RFP] III. FLPon::mScarlet-I tag inserted into endogenous unc-10 locus. GFP tag inserted into endogenous syd-2 locus with (517-836) region replaced by worm-optimized FUS 1-163. Reference: McDonald NA, et al. Nature. 2020 Dec;588(7838):454-458. PMID: 33208945."
Proper citation: RRID:WB-STRAIN:WBStrain00063237 Copy
http://www.wormbase.org/db/get?name=WBStrain00063234
Source Database: WormBase (WB)
Affected Genes: WBGene00006364(syd-2)|WBGene00006750(unc-10)
Genomic Alteration: WBGene00006364(syd-2), WBGene00006750(unc-10)
Availability: unknown
Source References: EMPTY
Synonyms: wyIs891 III; unc-10(wy1235[unc-10::FLPon::mScarlet-I]) syd-2(wy5) X.
Notes: Made_by: Nathan McDonald|"wyIs891 [unc-86p::FLP + odr-1p::RFP] III. FLPon::mScarlet-I tag inserted into endogenous unc-10 locus. Reference: McDonald NA, et al. Nature. 2020 Dec;588(7838):454-458. PMID: 33208945."
Proper citation: RRID:WB-STRAIN:WBStrain00063234 Copy
http://www.wormbase.org/db/get?name=WBStrain00063235
Source Database: WormBase (WB)
Affected Genes: WBGene00004267(rab-3)|WBGene00006364(syd-2)
Genomic Alteration: WBGene00004267(rab-3), WBGene00006364(syd-2)
Availability: unknown
Source References: EMPTY
Synonyms: rab-3(wy1332[mScarlet-I::FLPon::rab-3B]) II; wyIs891 III; syd-2(wy1052[GFP::syd-2]) X.
Notes: Made_by: Nathan McDonald|"wyIs891 [unc-86p::FLP + odr-1p::RFP] III. mScarlet-I::FLPon tag inserted into endogenous rab-3 locus specifically tagging isoform B, which is most abundant in neurons. GFP tag inserted into N-terminus of endogenous syd-2 locus. Reference: McDonald NA, et al. Nature. 2020 Dec;588(7838):454-458. PMID: 33208945."
Proper citation: RRID:WB-STRAIN:WBStrain00063235 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the T1D Resources search. From here you can search through a compilation of resources used by T1D and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that T1D has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on T1D then you can log in from here to get additional features in T1D such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into T1D you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within T1D that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
