Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00062846
Source Database: WormBase (WB)
Affected Genes: WBGene00002988(lim-6)
Genomic Alteration: WBGene00002988(lim-6)
Availability: unknown
Source References: EMPTY
Synonyms: Ctr-lim-6(ot1392[Ctr-lim-6::GFP]) X.
Notes: C-terminal GFP tag inserted before STOP codon of endogenous Ctr-lim-6 locus using CRISPR/Cas9. Generated in C. tropicalis NIC203 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https:|"Made_by: Itai Toker"
Proper citation: RRID:WB-STRAIN:WBStrain00062846 Copy
http://www.wormbase.org/db/get?name=WBStrain00062840
Source Database: WormBase (WB)
Affected Genes: WBGene00001864(him-5)
Genomic Alteration: WBGene00001864(him-5)
Availability: unknown
Source References: EMPTY
Synonyms: him-5(e1490) V; otIs810.
Notes: Made_by: Cyril Cros|"otIs810 [sto-3p::tagRFP + sto-3p::GFP::cla-1]."
Proper citation: RRID:WB-STRAIN:WBStrain00062840 Copy
http://www.wormbase.org/db/get?name=WBStrain00062841
Source Database: WormBase (WB)
Affected Genes: WBGene00001135(eat-4)
Genomic Alteration: WBGene00001135(eat-4)
Availability: unknown
Source References: EMPTY
Synonyms: Cbr-eat-4(ot1371[Cbr-eat-4::T2A::GFP::H2B]) III.
Notes: Made_by: Itai Toker|"T2A::GFP::H2B tag inserted before STOP codon of endogenous Cbr-eat-4 locus using CRISPR/Cas9. Generated in C. briggsae AF16 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https:"
Proper citation: RRID:WB-STRAIN:WBStrain00062841 Copy
http://www.wormbase.org/db/get?name=WBStrain00062845
Source Database: WormBase (WB)
Affected Genes: WBGene00002988(lim-6)
Genomic Alteration: WBGene00002988(lim-6)
Availability: unknown
Source References: EMPTY
Synonyms: lim-6(ot1391[lim-6::GFP]) X.
Notes: C-terminal GFP tag inserted before STOP codon of endogenous lim-6 locus using CRISPR/Cas9. Generated in N2 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https:|"Made_by: Itai Toker"
Proper citation: RRID:WB-STRAIN:WBStrain00062845 Copy
http://www.wormbase.org/db/get?name=WBStrain00062842
Source Database: WormBase (WB)
Affected Genes: WBGene00006762(unc-25)
Genomic Alteration: WBGene00006762(unc-25)
Availability: unknown
Source References: EMPTY
Synonyms: Cbr-unc-25(ot1373[Cbr-unc-25::T2A::GFP::H2B]) III.
Notes: Made_by: Itai Toker|"T2A::GFP::H2B tag inserted before STOP codon of endogenous Cbr-unc-25 locus using CRISPR/Cas9. Generated in C. briggsae AF16 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https:"
Proper citation: RRID:WB-STRAIN:WBStrain00062842 Copy
http://www.wormbase.org/db/get?name=WBStrain00062839
Source Database: WormBase (WB)
Affected Genes: WBGene00000912(daf-16)|WBGene00002084(ins-1)
Genomic Alteration: WBGene00000912(daf-16), WBGene00002084(ins-1)
Availability: unknown
Source References: EMPTY
Synonyms: daf-16(ot971[daf-16::GFP]) I; ins-1(ot1360) IV.
Notes: ot1360 is CRISPR-engineered 1,339 bp deletion removing the entire ins-1 coding region. Sequence after edit: TTATAGGGCATTTTTCAGTTCCTCACCGCTCTCAAATCAGGTCAATATCGTTGGCAGCTCACCGGACCCT. Reference: Sural S, et al. bioRxiv 2025.01.06.631508; doi: https:
Proper citation: RRID:WB-STRAIN:WBStrain00062839 Copy
http://www.wormbase.org/db/get?name=WBStrain00062948
Source Database: WormBase (WB)
Affected Genes: WBGene00000396(cdh-4)
Genomic Alteration: WBGene00000396(cdh-4)
Availability: unknown
Source References: EMPTY
Synonyms: cdh-4(syb6764[cdh-4::GFP]) III.
Notes: Made_by: SUNY Biotech|"SL2::GFP::H2B tag inserted at C-terminus of endogenous cdh-4 locus."
Proper citation: RRID:WB-STRAIN:WBStrain00062948 Copy
http://www.wormbase.org/db/get?name=WBStrain00062945
Source Database: WormBase (WB)
Affected Genes: WBGene00001961(hlh-17)|WBGene00009540(hlh-31)
Genomic Alteration: WBGene00001961(hlh-17), WBGene00009540(hlh-31)
Availability: unknown
Source References: EMPTY
Synonyms: hlh-17 hlh-31(syb6635) IV.
Notes: CRISPR/Cas9-engineered 5421 bp deletion entirely removing both hlh-17 and hlh-31. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329|"Made_by: SunyBiotech"
Proper citation: RRID:WB-STRAIN:WBStrain00062945 Copy
http://www.wormbase.org/db/get?name=WBStrain00062949
Source Database: WormBase (WB)
Affected Genes: WBGene00001961(hlh-17)|WBGene00009540(hlh-31)|WBGene00013665(hlh-32)
Genomic Alteration: WBGene00001961(hlh-17), WBGene00009540(hlh-31), WBGene00013665(hlh-32)
Availability: unknown
Source References: EMPTY
Synonyms: hlh-17 hlh-31(syb6635) hlh-32(syb6773) IV.
Notes: Made_by: SunyBiotech|"Triple mutant for hlh-17, hlh-31, and hlh-32. CRISPR/Cas9-engineered 1691 bp deletion of the entire hlh-32 locus in hlh-17 hlh-31(syb6635) double mutant parental strain. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329"
Proper citation: RRID:WB-STRAIN:WBStrain00062949 Copy
http://www.wormbase.org/db/get?name=WBStrain00062940
Source Database: WormBase (WB)
Affected Genes: WBGene00013665(hlh-32)
Genomic Alteration: WBGene00013665(hlh-32)
Availability: unknown
Source References: EMPTY
Synonyms: hlh-32(syb6078[hlh-32::GFP]) IV.
Notes: Endogenous locus tagged with GFP at C-terminus using CRISPR/Cas9. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329|"Made_by: SunyBiotech"
Proper citation: RRID:WB-STRAIN:WBStrain00062940 Copy
http://www.wormbase.org/db/get?name=WBStrain00062943
Source Database: WormBase (WB)
Affected Genes: WBGene00001918(his-44)|WBGene00002118(ins-35)
Genomic Alteration: WBGene00001918(his-44), WBGene00002118(ins-35)
Availability: unknown
Source References: EMPTY
Synonyms: ins-35(syb6236[ins-35::SL2::GFP::his-44]) V.
Notes: Made_by: Suny Biotech|"SL2::GFP::HIS-44 tag inserted into the endogenous ins-35 locus. Reference: Sural S, et al. bioRxiv 2025.01.06.631508; doi: https:"
Proper citation: RRID:WB-STRAIN:WBStrain00062943 Copy
http://www.wormbase.org/db/get?name=WBStrain00062944
Source Database: WormBase (WB)
Affected Genes: WBGene00001961(hlh-17)
Genomic Alteration: WBGene00001961(hlh-17)
Availability: unknown
Source References: EMPTY
Synonyms: hlh-17(syb6303[hlh-17::GFP]) IV.
Notes: Endogenous locus tagged with GFP at C-terminus using CRISPR/Cas9. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329|"Made_by: SunyBiotech"
Proper citation: RRID:WB-STRAIN:WBStrain00062944 Copy
http://www.wormbase.org/db/get?name=WBStrain00062941
Source Database: WormBase (WB)
Affected Genes: WBGene00009540(hlh-31)
Genomic Alteration: WBGene00009540(hlh-31)
Availability: unknown
Source References: EMPTY
Synonyms: hlh-31(syb6112[hlh-31::GFP]) IV.
Notes: Endogenous locus tagged with GFP at C-terminus using CRISPR/Cas9. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329|"Made_by: SunyBiotech"
Proper citation: RRID:WB-STRAIN:WBStrain00062941 Copy
http://www.wormbase.org/db/get?name=WBStrain00062995
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: Y51H7BR.7(ve891[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II.
Notes: Homozygous viable. Deletion of 2929 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TAATTTTTCACCAATTGCTGCACGGGCACC ; Right flanking sequence: GCCTGAGACATTTTGTGTccaaaaaaagac. Y51H7BR.7 sgRNA A: AGCTCAGGAAGTCCGCCCGG; Y51H7BR.7 sgRNA B: TAGTTCCGCCAAACACGCAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00062995 Copy
http://www.wormbase.org/db/get?name=WBStrain00062999
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: Y67A6A.1(ve896[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I.
Notes: Homozygous viable. Deletion of 583 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTTATTAAAATACAATACTAAAAGATTCCT ; Right flanking sequence: CTTTTATGCTACGAACGCAGTGAAAAACTC. Y67A6A.1 sgRNA A: GTCGAGAAACTGAAGCAAAA; Y67A6A.1 sgRNA B: CTCTGCTCGAGTCACAACTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00062999 Copy
http://www.wormbase.org/db/get?name=WBStrain00062997
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00007643(marc-3)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00007643(marc-3)
Availability: unknown
Source References: EMPTY
Synonyms: marc-3(ve893[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I.
Notes: Homozygous viable. Deletion of 1895 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTTTCAAGAGTCTCCACATGGAAACGACCT ; Right flanking sequence: CGCTGGACCCAGCGATGCGTTGAAGTCTTC. marc-3 sgRNA #1: GTAACTATTGATTCGCAACG; marc-3 sgRNA #2: GTGTGTCGGATATGTATGTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00062997 Copy
http://www.wormbase.org/db/get?name=WBStrain00062989
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: slc-17.1(ve883[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X.
Notes: Homozygous viable. Deletion of 3946 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AGATATGTTGACCATCTATTCCAGCTGTCC ; Right flanking sequence: TTCGAGAGCCAGTTAGAACTCAAAATGAGT. slc-17.1 sgRNA A: GACAAAGGAAGTGTGCTCTG; slc-17.2 sgRNA B: ACGTTGTGCGAAAAAGATGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00062989 Copy
http://www.wormbase.org/db/get?name=WBStrain00063030
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: R02F2.1(ve930[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III.
Notes: Homozygous viable. Deletion of 4303 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CCATCTTCTACTGTCATTTCCAAATTCCCA ; Right flanking sequence: CTCTCATACTAATACAAATTCTATATATAT. R02F2.1 sgRNA A: CTCGTCTTCGTTCTGTAACA; R02F2.1 sgRNA B: AGATGGTGTGTGGGGGAATG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00063030 Copy
http://www.wormbase.org/db/get?name=WBStrain00063034
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00015337(gsto-2)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00015337(gsto-2)
Availability: unknown
Source References: EMPTY
Synonyms: gsto-2(ve934[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III.
Notes: Homozygous viable. Deletion of 1049 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAGTGCAATTTGTCATCATGTAGGCTTCCG ; Right flanking sequence: TGGATTGTAAATATCTTCTCTTCGTTACAA. gsto-2 sgRNA A: GGGAAGGAAGTAAACACAGG; gsto-2 sgRNA B: GGAGCACCAAACTTTGACTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00063034 Copy
http://www.wormbase.org/db/get?name=WBStrain00062980
Source Database: WormBase (WB)
Affected Genes: WBGene00001064(dpy-2)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00015841(skpo-2)
Genomic Alteration: WBGene00001064(dpy-2), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00015841(skpo-2)
Availability: unknown
Source References: EMPTY
Synonyms: skpo-2(ve832[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/tmC6[dpy-2(tmIs1208)] II.
Notes: Made_by: RG KO Group|"tmIs1208 [myo-2p::mCherry, II: dpy-2] II. Embryonic lethal. Deletion of 3081 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mCherry+, and segregate wild-type GFP+ mCherry+, GFP+ non-mCherry dead eggs (ve832 homozygotes) and Dpy non-GFP mCherry+ (tmC6 homozygotes). Maintain by picking wild-type GFP+ mCherry+. Left flanking Sequence: GTGGGGAAAGATGCTAGACGGCTAGCTCCT; Right flanking sequence: AGGTCGTGGCGATCTTTGCAGGATTTGCTG. skpo-2 sgRNA #1: GGACTACAATGCCTGGAAAG; skpo-2 sgRNA #2: TCGAGGACCAGAATTTACAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."
Proper citation: RRID:WB-STRAIN:WBStrain00062980 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the T1D Resources search. From here you can search through a compilation of resources used by T1D and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that T1D has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on T1D then you can log in from here to get additional features in T1D such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into T1D you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within T1D that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.