Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Database:WB (facet)

Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

64,152 Results - per page

Show More Columns | Download Top 1000 Results

Organism Name Proper Citation Species Synonyms Notes Phenotype Affected Gene Genomic Alteration Catalog Number Background Database Database Abbreviation Availability Source References Alternate IDs Record Last Update Mentions Count
src-1(lq185)/tmC20 [unc-14(tmIs1219) dpy-5(tm9715)] I; juIs76 II.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00062741 Caenorhabditis elegans src-1(lq185)/tmC20 [unc-14(tmIs1219) dpy-5(tm9715)] I; juIs76 II. juIs76 [unc-25p::GFP + lin-15(+)] II. Precise deletion of src-1 generated by Cas9 genome editing. Balancer marked with myo-2p::Venus. Heterozygotes are wild-type with Venus+ pharynx, and will segregate wild-type with Venus+ pharynx (heterozygotes), sterile adults without Venus in pharynx (lq185 homozygotes), and Dpy with Venus+ pharynx (tmC20 homozygotes). GFP expression in GABAergic motor neurons. Reference: Mahadik S, et al. bioRxiv 2023.05.20.541322; doi: https: WBGene00001067(dpy-5)|WBGene00005077(src-1)|WBGene00006753(unc-14) WBGene00001067(dpy-5), WBGene00005077(src-1), WBGene00006753(unc-14) WB-STRAIN:WBStrain00062741 WormBase (WB) WB unknown 2026-09-05 04:59:45 0
Propanagrolaimus sp. wild isolate.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00062740 Propanagrolaimus sp. Propanagrolaimus sp. wild isolate. Propanagrolaimus sp. wild isolate. Can be maintained and frozen using C. elegans conditions. Reference: Schiffer PH, et al. Dev Genes Evol. 2014 Jun;224(3):183-8. doi: 10.1007/s00427-014-0471-2. PMID: 24849338. WB-STRAIN:WBStrain00062740 WormBase (WB) WB unknown 2026-09-05 04:59:45 0
unc-94b(cp438[mNG-C1::unc-94b]) I.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00062744 Caenorhabditis elegans unc-94b(cp438[mNG-C1::unc-94b]) I. Made_by: Pu Zhang|"mNG reporter inserted into endogenous unc-94b locus, specifically tagging the UNC-94B isoform. Reference: Zhang P, et al. 2023 Sep 4;222(9):e202302102. doi: 10.1083/jcb.202302102. PMID: 37351566." WBGene00006823(unc-94) WBGene00006823(unc-94) WB-STRAIN:WBStrain00062744 WormBase (WB) WB unknown 2026-09-05 04:59:45 0
ceh-38(tm321) II; ceh-44(ot1015[ceh-44::gfp]) III; ceh-48(tm6112) IV; otDf1 X.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00062837 Caenorhabditis elegans ceh-38(tm321) II; ceh-44(ot1015[ceh-44::gfp]) III; ceh-48(tm6112) IV; otDf1 X. Made_by: Michael Cesar|"ot1015 is a GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. CUT Quintuple-mutant background. Reduced pan-neuronal nuclear CEH-44::GFP expression. Please contact Oliver Hobert prior to publishing work using this strain." WBGene00000459(ceh-38)|WBGene00000464(ceh-44)|WBGene00015934(ceh-48) WBGene00000459(ceh-38), WBGene00000464(ceh-44), WBGene00015934(ceh-48) WB-STRAIN:WBStrain00062837 WormBase (WB) WB unknown 2026-09-05 04:59:46 0
aex-1(ot1357) I.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00062838 Caenorhabditis elegans aex-1(ot1357) I. ot1357 is CRISPR-engineered 5,741 bp deletion removing the entire aex-1 coding region, eliminating all spice isoforms. Sequence after edit: ACTTTTAACATTTTTAAAGCATTAGTTTTCCTTATGAATAGTCTATATTTTATCGACTGGCCGACATAAt. Reference: Sural S, et al. bioRxiv 2025.01.06.631508; doi: https: WBGene00000084(aex-1) WBGene00000084(aex-1) WB-STRAIN:WBStrain00062838 WormBase (WB) WB unknown 2026-09-05 04:59:46 0
ins-18(ot1326) daf-16(ot971[daf-16::GFP]) I.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00062835 Caenorhabditis elegans ins-18(ot1326) daf-16(ot971[daf-16::GFP]) I. ot1326 is CRISPR-engineered 2,029 bp deletion removing the entire ins-18 coding region. Sequence after edit: AGCTCATTTTAATTTAACACAATGGTCCACCGACTACGTGGAAGATCTTCTTGCCTACTGTGCCCCAATT. Reference: Sural S, et al. bioRxiv 2025.01.06.631508; doi: https: WBGene00000912(daf-16)|WBGene00002101(ins-18) WBGene00000912(daf-16), WBGene00002101(ins-18) WB-STRAIN:WBStrain00062835 WormBase (WB) WB unknown 2026-09-05 04:59:46 0
qySi205 I; sec-16A.1(qy234[mNG::sec16A.1]) III.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00062797 Caenorhabditis elegans qySi205 I; sec-16A.1(qy234[mNG::sec16A.1]) III. Made_by: Sherwood Lab|"qySi205 [lin-29p::icmt-1::mscarlet] I. MosSCI single copy insertion for anchor cell specific expression of prenylation enzyme icmt-1 and sec-16A.1 locus endogenously tagged with mNG at the N-terminus. Superficially wild-type. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804." WB-STRAIN:WBStrain00062797 WormBase (WB) WB unknown 2026-09-05 04:59:46 0
cdh-9(ot1247) X.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00062830 Caenorhabditis elegans cdh-9(ot1247) X. CRISPR/Cas9 engineered deletion of full cdh-9 locus.|"Made_by: Maryam Majeed" WBGene00000401(cdh-9) WBGene00000401(cdh-9) WB-STRAIN:WBStrain00062830 WormBase (WB) WB unknown 2026-09-05 04:59:46 0
qySi229 I.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00062795 Caenorhabditis elegans qySi229 I. Made_by: Sherwood Lab|"qySi229 [cdh-3p::lmp-1::mNG] I. MosSCI single copy insertion. Anchor cell specific expression of lysosomal protein lmp-1. Superficially wild-type. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804." WB-STRAIN:WBStrain00062795 WormBase (WB) WB unknown 2026-09-05 04:59:46 0
ceh-44(ot1294[*ot1015[ceh-44::gfp]]) III.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00062833 Caenorhabditis elegans ceh-44(ot1294[*ot1015[ceh-44::gfp]]) III. Made_by: Michael Cesar|"ot1015 is a GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. ot1294 is a deletion removing intron 7 from the endogenously-tagged ceh-44 locus, which also removes the UNC-75 binding site. No pan-neuronal nuclear GFP expression. Please contact Oliver Hobert prior to publishing work using this strain." WBGene00000464(ceh-44) WBGene00000464(ceh-44) WB-STRAIN:WBStrain00062833 WormBase (WB) WB unknown 2026-09-05 04:59:46 0
ceh-44(ot1402[*ot1015[ceh-44::gfp]]) III.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00062834 Caenorhabditis elegans ceh-44(ot1402[*ot1015[ceh-44::gfp]]) III. Made_by: Michael Cesar|"ot1015 is a GFP tag inserted at the C-terminus of the endogenous ceh-44 locus by CRISPR. ot1402 is a deletion removing the UNC-75 binding site within intron 7 of the endogenously-tagged ceh-44 locus. Reduced pan-neuronal nuclear CEH-44::GFP expression. Please contact Oliver Hobert prior to publishing work using this strain." WBGene00000464(ceh-44) WBGene00000464(ceh-44) WB-STRAIN:WBStrain00062834 WormBase (WB) WB unknown 2026-09-05 04:59:46 0
rrf-3(pk1426) II; qyIs221.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00062798 Caenorhabditis elegans rrf-3(pk1426) II; qyIs221. Made_by: Sherwood Lab|"qyIs221 [cdh-3p::GFP::ced-10]. Maintain at 20C or lower. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804." WBGene00004510(rrf-3) WBGene00004510(rrf-3) WB-STRAIN:WBStrain00062798 WormBase (WB) WB unknown 2026-09-05 04:59:46 0
ins-7(syb5424[ins-7::SL2::GFP::his-44]) IV.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00062934 Caenorhabditis elegans ins-7(syb5424[ins-7::SL2::GFP::his-44]) IV. Made_by: Suny Biotech|"SL2::GFP::HIS-44 tag inserted into the endogenous ins-7 locus. Reference: Sural S, et al. bioRxiv 2025.01.06.631508; doi: https:" WBGene00001918(his-44)|WBGene00002090(ins-7) WBGene00001918(his-44), WBGene00002090(ins-7) WB-STRAIN:WBStrain00062934 WormBase (WB) WB unknown 2026-09-05 04:59:47 0
gbb-2(syb5759[gbb-2::sl2::gfp::h2b]) IV.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00062938 Caenorhabditis elegans gbb-2(syb5759[gbb-2::sl2::gfp::h2b]) IV. Made_by: SunyBiotech|"SL2::GFP::H2B tags inserted at C-terminus of gbb-2 endogenous locus. Reference: Stefanakis N, et al. 2024 Feb 15. doi: 10.1038/s44318-024-00049-w. PMID: 38360995." WBGene00022675(gbb-2) WBGene00022675(gbb-2) WB-STRAIN:WBStrain00062938 WormBase (WB) WB unknown 2026-09-05 04:59:47 0
aex-5(ot1532[aex-5::SL2::gfp::his-44]) I.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00062892 Caenorhabditis elegans aex-5(ot1532[aex-5::SL2::gfp::his-44]) I. SL2::GFP::HIS-44 tag inserted into the endogenous aex-5 locus. Reference: Sural S, et al. bioRxiv 2025.01.06.631508; doi: https: WBGene00000088(aex-5)|WBGene00001918(his-44) WBGene00000088(aex-5), WBGene00001918(his-44) WB-STRAIN:WBStrain00062892 WormBase (WB) WB unknown 2026-09-05 04:59:47 0
otIs927 V.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00062896 Caenorhabditis elegans otIs927 V. otIs927 [ges-1p::nlp-40::tagRFP-T::SL2::GFP::his-44::tbb-2 3 UTR + inx-6(prom18)::tagRFP-T::unc-54 3' UTR] V. Transgene allows monitoring of the secretion of NLP-40 neuropeptide from the intestine under different physiological conditions. The multicopy array was inserted at the oxTi553 landing site using the Fluorescent Landmark Interference (FLInt) method. Reference: Sural S, et al. bioRxiv 2025.01.06.631508; doi: https: WB-STRAIN:WBStrain00062896 WormBase (WB) WB unknown 2026-09-05 04:59:47 0
unc-75(ot1539[mScarlet-I3::unc-75]) I.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00062893 Caenorhabditis elegans unc-75(ot1539[mScarlet-I3::unc-75]) I. Made_by: Karinna Pe (Hobert Lab)|"mScarlet-I3 tag inserted into endogenous unc-75 locus via CRISPR/Cas9 engineering. Reference: Cao WX, et al. (2024). bioRxiv: 2024.2006.2011.598534. https:" WBGene00006807(unc-75) WBGene00006807(unc-75) WB-STRAIN:WBStrain00062893 WormBase (WB) WB unknown 2026-09-05 04:59:47 0
aex-1(ot1543[aex-1::SL2::gfp::his-44]) I.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00062894 Caenorhabditis elegans aex-1(ot1543[aex-1::SL2::gfp::his-44]) I. SL2::GFP::HIS-44 tag inserted into the endogenous aex-1 locus. Reference: Sural S, et al. bioRxiv 2025.01.06.631508; doi: https: WBGene00000084(aex-1)|WBGene00001918(his-44) WBGene00000084(aex-1), WBGene00001918(his-44) WB-STRAIN:WBStrain00062894 WormBase (WB) WB unknown 2026-09-05 04:59:47 0
Cbr-cat-1(ot1621[Cbr-cat-1::SL2::mScarlet3::H2B]) X.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00062899 Caenorhabditis briggsae Cbr-cat-1(ot1621[Cbr-cat-1::SL2::mScarlet3::H2B]) X. Made_by: Itai Toker|"SL2::mScarlet3::H2B tag inserted before STOP codon of endogenous Cbr-cat-1 locus using CRISPR/Cas9. Generated in C. briggsae AF16 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https:" WBGene00000295(cat-1) WBGene00000295(cat-1) WB-STRAIN:WBStrain00062899 WormBase (WB) WB unknown 2026-09-05 04:59:47 0
rol-1::mNG(syb5033) II.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00062933 Caenorhabditis elegans rol-1::mNG(syb5033) II. Made_by: SunyBiotech|"mNG inserted at C-terminus of endogenous rol-1 locus." WBGene00004394(rol-1) WBGene00004394(rol-1) WB-STRAIN:WBStrain00062933 WormBase (WB) WB unknown 2026-09-05 04:59:47 0

Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
X
  1. Type 1 Diabetes Research Networks Resources

    Welcome to the T1D Resources search. From here you can search through a compilation of resources used by T1D and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that T1D has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on T1D then you can log in from here to get additional features in T1D such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into T1D you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.