Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00030725
Source Database: WormBase (WB)
Affected Genes: WBGene00003965(pdk-1)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003965(pdk-1), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: ccIs55 V; pdk-1(mg142) X.
Alternate IDs: WB-STRAIN:PJ1134, CGC_PJ1134
Notes: ccIs55 [unc-54::lacZ + sup-7(st5)] V. No visible phenotype (may be smallish??). Dominant suppressor of daf-c phenotype of age-1.
Proper citation: RRID:WB-STRAIN:WBStrain00030725 Copy
http://www.wormbase.org/db/get?name=WBStrain00030723
Source Database: WormBase (WB)
Affected Genes: WBGene00000548(clr-1)|WBGene00004774(sem-5)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00000548(clr-1), WBGene00004774(sem-5), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: clr-1(e1745) II; ccIs55 V; sem-5(n1779) X.
Alternate IDs: WB-STRAIN:PJ1126, CGC_PJ1126
Notes: ccIs55 [unc-54::lacZ + sup-7(st5)] V. clr-1 is temperature-sensitive. n1779 suppresses clr-1.
Proper citation: RRID:WB-STRAIN:WBStrain00030723 Copy
http://www.wormbase.org/db/get?name=WBStrain00030702
Source Database: WormBase (WB)
Affected Genes: WBGene00002335(let-60)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00002335(let-60), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: let-60(ga89) IV; ccIs55 V.
Alternate IDs: WB-STRAIN:PJ1063, CGC_PJ1063
Notes: ccIs55 [unc-54::lacZ + sup-7(st5)] V. Temperature sensitive. Nearly WT at 15C. At 20C the animals are 18% Muv and brood size is 88. At 25C the animals are 57% Muv and are almost sterile (brood size is 6).
Proper citation: RRID:WB-STRAIN:WBStrain00030702 Copy
http://www.wormbase.org/db/get?name=WBStrain00030708
Source Database: WormBase (WB)
Affected Genes: WBGene00000548(clr-1)|WBGene00001184(egl-15)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00000548(clr-1), WBGene00001184(egl-15), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: clr-1(e1745) II; ccIs55 V; egl-15(n1783) X.
Alternate IDs: WB-STRAIN:PJ1078, CGC_PJ1078
Notes: ccIs55 [unc-54::lacZ + sup-7(st5)] V. Non-Egl. Non-Scrawny. Class IV egl-15 mutation. Supresses the temperature-sensitive Clr phenotype.
Proper citation: RRID:WB-STRAIN:WBStrain00030708 Copy
http://www.wormbase.org/db/get?name=WBStrain00030735
Source Database: WormBase (WB)
Affected Genes: WBGene00000898(daf-2)|WBGene00002992(lin-3)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00000898(daf-2), WBGene00002992(lin-3), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: daf-2(m41) III; ccIs55 V; njEx38.
Alternate IDs: WB-STRAIN:PJ1166, CGC_PJ1166
Notes: ccIs55 [unc-54::lacZ + sup-7(st5)] V. njEx38 [unc-54p::daf-2(+) + goa-1p::GFP + rol-6(su1006)]. Maintain by picking Rollers. Arrest as dauers at 25C. Maintain at 15C.
Proper citation: RRID:WB-STRAIN:WBStrain00030735 Copy
http://www.wormbase.org/db/get?name=WBStrain00030822
Source Database: WormBase (WB)
Affected Genes: WBGene00006789(unc-54)|WBGene00006829(unc-101)
Genomic Alteration: WBGene00006789(unc-54), WBGene00006829(unc-101)
Availability: available
Source References: PMID:8288128
Synonyms: unc-101(sy216)/hIn1 [unc-54(h1040)] I.
Alternate IDs: WB-STRAIN:PS968, CGC_PS968
Notes: Heterozygotes are WT and segregate embryonic lethals (sy216 homozygotes) and paralyzed Uncs (h1040 homozygotes). sy216 is a deletion of the unc-101 gene region. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Mutagen: Trimethylpsoalen"
Proper citation: RRID:WB-STRAIN:WBStrain00030822 Copy
http://www.wormbase.org/db/get?name=WBStrain00030966
Source Database: WormBase (WB)
Affected Genes: WBGene00004202(pry-1)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00004202(pry-1), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: pry-1(mu38)/hIn1 [unc-54(h1040)] I; syIs188.
Alternate IDs: WB-STRAIN:PS5551, CGC_PS5551
Notes: syIs188 [POPTOP + unc-119(+)]. Maintain by picking non-Uncs. syIs188 suppresses pry-1(mu38) Muv phenotype. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
Proper citation: RRID:WB-STRAIN:WBStrain00030966 Copy
http://www.wormbase.org/db/get?name=WBStrain00033362
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00018237(irg-7)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00018237(irg-7)
Availability: available
Source References: EMPTY
Synonyms: irg-7(ve536[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X.
Alternate IDs: WB-STRAIN:RG3036, CGC_RG3036
Notes: Homozygous viable. Deletion of 5265 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ccTTAGTTGTTGATACAGTAGACACCTCCA ; Right flanking sequence: GCTACAATTGTAACGTAGTCAACGCTAAGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 5265 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: ccTTAGTTGTTGATACAGTAGACACCTCCA ; Right flanking sequence: GCTACAATTGTAACGTAGTCAACGCTAAGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of irg-7. Insertion site verified by PCR. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: ccTTAGTTGTTGATACAGTAGACACCTCCA Right flanking sequence: GCTACAATTGTAACGTAGTCAACGCTAAGA"
Proper citation: RRID:WB-STRAIN:WBStrain00033362 Copy
http://www.wormbase.org/db/get?name=WBStrain00033365
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00009589(spe-36)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00009589(spe-36)
Availability: available
Source References: EMPTY
Synonyms: spe-36(ve539[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1[umnIs49] IV; +/nT1 V.
Alternate IDs: WB-STRAIN:RG3039, CGC_RG3039
Notes: F40F11.4. umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous Ste, lays only oocytes. Deletion of 2632 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, Ste GFP+ non-mKate2 (ve539 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: tcacaaaaactcacAAATAACTTTGTACCG ; Right flanking sequence: ACGCAAGAGCTATGAAGAACAGAATACATA. sgRNA #1: acAAATAACTTTGTACCGGG; sgRNA #2: CTTCATAGCTCTTGCGTCAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of F40F11.4. Insertion site verified by PCR. umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, ve539 homozygotes (Ste, lays only oocytes, GFP+ mKate-), Vul nT1 homozygotes (brighter mKate2+) and dead eggs. Maintain by picking wild-type GFP+ mKate2+. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: aaaactcacAAATAACTTTGTACCG Right flanking sequence: ACGCAAGAGCTATGAAGAACAGAAT"
Proper citation: RRID:WB-STRAIN:WBStrain00033365 Copy
http://www.wormbase.org/db/get?name=WBStrain00033366
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: K06A9.3(ve541[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X.
Alternate IDs: WB-STRAIN:RG3041, CGC_RG3041
Notes: Homozygous viable. Deletion of 469 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: tgtcagaatcacaaaaaattatgttttttt ; Right flanking sequence: GGAGGGGCACATAGAATCAATCATGCGCGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of K06A9.3. Insertion site verified by PCR. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: gaatcacaaaaaattatgttttttt Right flanking sequence: GGAGGGGCACATAGAATCAATCATG"
Proper citation: RRID:WB-STRAIN:WBStrain00033366 Copy
http://www.wormbase.org/db/get?name=WBStrain00033347
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00005050(sra-24)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00005050(sra-24), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: sra-24(ve520[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II.
Alternate IDs: WB-STRAIN:RG3020, CGC_RG3020
Notes: Homozygous viable. Deletion of 1150 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CCGAAGGTCTCACCAATGCATTGACCTCGA ; Right flanking sequence: CTTGGCGTTAATTATTTGAGAATATTCAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 1150 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: CCGAAGGTCTCACCAATGCATTGACCTCGA ; Right flanking sequence: CTTGGCGTTAATTATTTGAGAATATTCAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of sra-39. Insertion site verified by PCR. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: TGAATTCGGTCTTGCCTCTTTTTTCCTAAC Right flanking sequence: TGAGGTACCTTGAAAAATAATAGCAAATAA"
Proper citation: RRID:WB-STRAIN:WBStrain00033347 Copy
http://www.wormbase.org/db/get?name=WBStrain00033348
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00005059(sra-33)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00005059(sra-33), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: sra-33(ve521[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II.
Alternate IDs: WB-STRAIN:RG3021, CGC_RG3021
Notes: Homozygous viable. Deletion of 2545 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aaaaatcatcaaaatTCATTTATTCCACAT ; Right flanking sequence: gcacaaataatatgtgaaaaggggaacctt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 2545 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: aaaaatcatcaaaatTCATTTATTCCACAT ; Right flanking sequence: gcacaaataatatgtgaaaaggggaacctt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of sra-33. Insertion site verified by PCR. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: aaaaatcatcaaaatTCATTTATTCCACAT Right flanking sequence: gcacaaataatatgtgaaaaggggaacctt"
Proper citation: RRID:WB-STRAIN:WBStrain00033348 Copy
http://www.wormbase.org/db/get?name=WBStrain00033349
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00005047(sra-21)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00005047(sra-21), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: sra-21(ve522[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II.
Alternate IDs: WB-STRAIN:RG3022, CGC_RG3022
Notes: Homozygous viable. Deletion of 1748 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tagagcagaaaccacacatctgctcacaga ; Right flanking sequence: tctggactgttattgaaagttttacgggtg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 1748 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: tagagcagaaaccacacatctgctcacaga ; Right flanking sequence: tctggactgttattgaaagttttacgggtg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of sra-21. Insertion site verified by PCR. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: tagagcagaaaccacacatctgctcacaga Right flanking sequence: tctggactgttattgaaagttttacgggtg"
Proper citation: RRID:WB-STRAIN:WBStrain00033349 Copy
http://www.wormbase.org/db/get?name=WBStrain00033342
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00005038(sra-12)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00005038(sra-12), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: sra-12(ve515[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II.
Alternate IDs: WB-STRAIN:RG3015, CGC_RG3015
Notes: Homozygous viable. Deletion of 1064 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AGTATTAGTGGAGCCAGAGAAACACAGGCA ; Right flanking sequence: CACGGGTACTTATTAATGGATAACACGAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 1064 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: AGTATTAGTGGAGCCAGAGAAACACAGGCA ; Right flanking sequence: CACGGGTACTTATTAATGGATAACACGAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of sra-12. Insertion site verified by PCR. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: AGTATTAGTGGAGCCAGAGAAACACAGGCA Right flanking sequence: CACGGGTACTTATTAATGGATAACACGAGG"
Proper citation: RRID:WB-STRAIN:WBStrain00033342 Copy
http://www.wormbase.org/db/get?name=WBStrain00033345
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00005065(sra-39)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00005065(sra-39), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: sra-39(ve518[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II.
Alternate IDs: WB-STRAIN:RG3018, CGC_RG3018
Notes: Homozygous viable. Deletion of 2040 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TGAATTCGGTCTTGCCTCTTTTTTCCTAAC ; Right flanking sequence: TGAGGTACCTTGAAAAATAATAGCAAATAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 2040 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: TGAATTCGGTCTTGCCTCTTTTTTCCTAAC ; Right flanking sequence: TGAGGTACCTTGAAAAATAATAGCAAATAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: Emily Lorenz-Mueller"|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of sra-39. Insertion site verified by PCR. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: TGAATTCGGTCTTGCCTCTTTTTTCCTAAC Right flanking sequence: TGAGGTACCTTGAAAAATAATAGCAAATAA"
Proper citation: RRID:WB-STRAIN:WBStrain00033345 Copy
http://www.wormbase.org/db/get?name=WBStrain00033346
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00005058(sra-32)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00005058(sra-32), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: sra-32(ve519[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II.
Alternate IDs: WB-STRAIN:RG3019, CGC_RG3019
Notes: Homozygous viable. Deletion of 1878 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: gtcaaatatgttccagtttttataccactc ; Right flanking sequence: ggtggttttgattattaatgggagcaaaaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 1878 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: gtcaaatatgttccagtttttataccactc ; Right flanking sequence: ggtggttttgattattaatgggagcaaaaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of sra-9. Insertion site verified by PCR. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: ttcagtttcaagatttcATGGCTACCATAG Right flanking sequence: ataggctgaaccaaaaaagtacatcgagtt"
Proper citation: RRID:WB-STRAIN:WBStrain00033346 Copy
http://www.wormbase.org/db/get?name=WBStrain00033358
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: F53C11.9(ve531[LoxP+ myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR +LoxP]) V.
Alternate IDs: WB-STRAIN:RG3031, CGC_RG3031
Notes: Homozygous viable. Deletion of 349 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aattctcattgagaacatttcaacacacaa ; Right flanking sequence: CAAGGATTTGTTGTTGATTCAAATACCAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 349 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: aattctcattgagaacatttcaacacacaa ; Right flanking sequence: CAAGGATTTGTTGTTGATTCAAATACCAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of F53C11.9. Insertion site verified by PCR. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: aattctcattgagaacatttcaacacacaa Right flanking sequence: CAAGGATTTGTTGTTGATTCAAATACCAAA"
Proper citation: RRID:WB-STRAIN:WBStrain00033358 Copy
http://www.wormbase.org/db/get?name=WBStrain00033354
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: C40H5.2(ve527[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X.
Alternate IDs: WB-STRAIN:RG3027, CGC_RG3027
Notes: Homozygous viable. Deletion of 1675 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ccaggcaatgatcaacgATGTACGCCTTAT ; Right flanking sequence: TCTGGAAGATCTTGAAGACTCTGCCATTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 1675 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: ccaggcaatgatcaacgATGTACGCCTTAT ; Right flanking sequence: TCTGGAAGATCTTGAAGACTCTGCCATTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of C40H5.2. Insertion site verified by PCR. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: ccaggcaatgatcaacgATGTACGCCTTAT Right flanking sequence: TCTGGAAGATCTTGAAGACTCTGCCATTCT"
Proper citation: RRID:WB-STRAIN:WBStrain00033354 Copy
http://www.wormbase.org/db/get?name=WBStrain00033355
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: C40H5.7(ve528[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X.
Alternate IDs: WB-STRAIN:RG3028, CGC_RG3028
Notes: Homozygous viable. Deletion of 939 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTGTGAGCGAATTGTTAAATGGAGTGGCTT ; Right flanking sequence: atcacatgtcatatacagtattccattaaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 939 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: CTGTGAGCGAATTGTTAAATGGAGTGGCTT ; Right flanking sequence: atcacatgtcatatacagtattccattaaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of C40H5.7. Insertion site verified by PCR. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: CTGTGAGCGAATTGTTAAATGGAGTGGCTT Right flanking sequence: atcacatgtcatatacagtattccattaaa"
Proper citation: RRID:WB-STRAIN:WBStrain00033355 Copy
http://www.wormbase.org/db/get?name=WBStrain00033357
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: C46F4.3(ve530[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X.
Alternate IDs: WB-STRAIN:RG3030, CGC_RG3030
Notes: Homozygous viable. Deletion of 794 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATCTTACTTTCCGTTTCTGCAAAACAAGTG ; Right flanking sequence: GGAGGAGTCTGCAGACCGTCGACAAAGTGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 794 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: ATCTTACTTTCCGTTTCTGCAAAACAAGTG ; Right flanking sequence: GGAGGAGTCTGCAGACCGTCGACAAAGTGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of C46F4.3. Insertion site verified by PCR. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: ATCTTACTTTCCGTTTCTGCAAAACAAGTG Right flanking sequence: GGAGGAGTCTGCAGACCGTCGACAAAGTGC"
Proper citation: RRID:WB-STRAIN:WBStrain00033357 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the T1D Resources search. From here you can search through a compilation of resources used by T1D and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that T1D has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on T1D then you can log in from here to get additional features in T1D such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into T1D you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within T1D that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.