Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Search

Type in a keyword to search

On page 2 showing 21 ~ 40 out of 79 results
Snippet view Table view Download 79 Result(s)
Click the to add this resource to a Collection
  • RRID:RGD_13207595

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=13207595

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2021-11-03)
Alternate IDs: 13207595
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Tph1 gene of WKY/NCrl rat embryos. The resulting mutation is a 1-bp deletion in the exon 4 of the Tph1 gene. Contact MCW rat distribution at [email protected]

Proper citation: RRID:RGD_13207595 Copy   


  • RRID:RGD_13207494

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=13207494

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2021-11-03)
Alternate IDs: 13207494
Notes: CRISPR/Cas9 system was used to introduce a 22-bp deletion of exon 2 in the rat Cd55 gene of Crl:SD embryos. Contact MCW rat distribution at [email protected]

Proper citation: RRID:RGD_13207494 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=13204756

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2021-11-03)
Alternate IDs: 13204756
Notes: CRISPR/Cas9 system was used to introduce a 5-bp deletion in exon 2 of the rat Pappa2 gene of SS.BN-(D13Hmgc1048-D13Hmgc1050)/Mcwi rat embryos. Contact MCW rat distribution at [email protected]

Proper citation: RRID:RGD_13204756 Copy   


  • RRID:RGD_13800838

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=13800838

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2021-11-03)
Alternate IDs: 13800838
Notes: CRISPR/Cas9 system was used to introduce a 2-bp deletion in exon 1 of rat Mybphl gene in the FHH/EurMcwi embryos. Contact MCW rat distribution at [email protected]

Proper citation: RRID:RGD_13800838 Copy   


  • RRID:RGD_13207488

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=13207488

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2021-11-03)
Alternate IDs: 13207488
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Chrnb4 gene of LEW/NCrl rat embryos. The resulting mutation is a 4-bp deletion of exon 4 in the Chrnb4 gene. Contact MCW rat distribution at [email protected]

Proper citation: RRID:RGD_13207488 Copy   


  • RRID:RGD_13208231

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=13208231

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2021-11-03)
Alternate IDs: 13208231
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Tph1 gene of WKY/NCrl rat embryos. The resulting mutation is a 1-bp insertion in the exon 4 of the Tph1 gene. Contact MCW rat distribution at [email protected]

Proper citation: RRID:RGD_13208231 Copy   


  • RRID:RGD_13207497

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=13207497

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2021-11-03)
Alternate IDs: 13207497
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Kcnj13 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp insertion of exon 2 in the Kcnj13 gene. Contact MCW rat distribution at [email protected]

Proper citation: RRID:RGD_13207497 Copy   


  • RRID:RGD_14394496

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=14394496

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2021-11-03)
Alternate IDs: 14394496
Notes: CRISPR/Cas9 system was used to introduce a 2-bp deletion mutation in exon 1 of the Kcnj2 gene of SS/JrHsdMcwi rat embryos. Contact MCW rat distribution at [email protected]

Proper citation: RRID:RGD_14394496 Copy   


  • RRID:RGD_25330091

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=25330091

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2021-11-03)
Alternate IDs: 25330091
Notes: CRISPR/Cas9 system was used to introduce a 11-bp deletion in exon 19 of rat Rictor gene. Contact MCW rat distribution at [email protected]

Proper citation: RRID:RGD_25330091 Copy   


  • RRID:RGD_6484582

    This resource has 1+ mentions.

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=6484582

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2021-11-03)
Alternate IDs: 6484582
Notes: This strain was produced by injecting ZFNs targeting the sequence CTCGCCTGCATCCTTCAAGtgcagtTCCCAGGAGCAGGTAAGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 11-bp frameshift deletion in exon 1.

Proper citation: RRID:RGD_6484582 Copy   


  • RRID:RGD_10002794

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10002794

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2021-11-03)
Alternate IDs: 10002794
Notes: This strain was produced by injecting TALENs targeting the sequence CTTAGACAACTCTCAATAGCTttatgggcctcggccAAGCGGCATGGAAGGAGGC into Crl:SD rat embryos. The resulting mutation is a 1-bp frameshift deletion in exon 2.

Proper citation: RRID:RGD_10002794 Copy   


  • RRID:RGD_4139885

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=4139885

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2021-11-03)
Alternate IDs: 4139885
Notes: This strain was produced by injecting ZFNs targeting the sequence ctcccccatcccacttgaatgtggagcagcctgtg into SS/JrHsdMcwi rat embryos. The resulting mutation is an in-frame 6-bp deletion in exon 2.

Proper citation: RRID:RGD_4139885 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10054304

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2021-11-03)
Alternate IDs: 10054304
Notes: CRISPR/Cas9 system was used to introduce a 2-bp deletion in the Btg2 gene of SS.BN-(D13Rat25-rs106935835)/Mcwi rat embryos Contact MCW rat distribution at [email protected]

Proper citation: RRID:RGD_10054304 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10054299

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2021-11-03)
Alternate IDs: 10054299
Notes: CRISPR/Cas9 system was used to introduce a 16-bp deletion in the Btg2 gene of SS.BN-(D13Rat25-rs106935835)/Mcwi rat embryos. Contact MCW rat distribution at [email protected]

Proper citation: RRID:RGD_10054299 Copy   


  • RRID:RGD_11553894

    This resource has 1+ mentions.

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=11553894

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2021-11-03)
Alternate IDs: 11553894
Notes: ZFN system was used to introduce a mutation in the Tpcn2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 9-bp deletion in Exon 4 of theTpcn2 gene. Contact MCW rat distribution at [email protected]

Proper citation: RRID:RGD_11553894 Copy   


  • RRID:RGD_10059576

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10059576

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2021-11-03)
Alternate IDs: 10059576
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Sik2 gene of WKY/NCrl rat embryos. The resulting mutation is a 4-bp deletion in exon 4 of the Sik2 gene. Contact MCW rat distribution at [email protected]

Proper citation: RRID:RGD_10059576 Copy   


  • RRID:RGD_11553850

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=11553850

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2021-11-03)
Alternate IDs: 11553850
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Trpv4 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 4-bp deletion in Exon 4 of the Trpv4 gene. Contact MCW rat distribution at [email protected]

Proper citation: RRID:RGD_11553850 Copy   


  • RRID:RGD_12790599

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=12790599

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2021-11-03)
Alternate IDs: 12790599
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Asic3 gene of WKY/Ncrlrat embryos. The resulting mutation is a 61-bp deletion in the exon 1 of the Asic3 gene. Contact MCW rat distribution at [email protected]

Proper citation: RRID:RGD_12790599 Copy   


  • RRID:RGD_11553875

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=11553875

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2021-11-03)
Alternate IDs: 11553875
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Fmr1 gene of Crl:LE rat embryos. The resulting mutation is a 2-bp deletion in exon 8 of the Fmr1 gene. Contact MCW rat distribution at [email protected]

Proper citation: RRID:RGD_11553875 Copy   


  • RRID:RGD_12790610

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=12790610

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2021-11-03)
Alternate IDs: 12790610
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Cd14 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a net 7-bp deletion of the Cd14 gene. Contact MCW rat distribution at [email protected]

Proper citation: RRID:RGD_12790610 Copy   



Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
  1. Type 1 Diabetes Research Networks Resources

    Welcome to the T1D Resources search. From here you can search through a compilation of resources used by T1D and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that T1D has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on T1D then you can log in from here to get additional features in T1D such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into T1D you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within T1D that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X