Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00033323
Source Database: WormBase (WB)
Affected Genes: WBGene00000608(col-19)
Genomic Alteration: WBGene00000608(col-19)
Availability: unknown
Source References: EMPTY
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:RG365
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00033323 Copy
http://www.wormbase.org/db/get?name=WBStrain00033336
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00005054(sra-28)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00005054(sra-28), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: sra-28(ve507[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II.
Alternate IDs: WB-STRAIN:RG3007, CGC_RG3007
Notes: Homozygous viable. Deletion of 3237 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aggaaaattaaatttcaattttcttgttcc ; Right flanking sequence: ggaggtgttagcttttaaaatatgactggt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 3237 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: aggaaaattaaatttcaattttcttgttcc ; Right flanking sequence: ggaggtgttagcttttaaaatatgactggt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of sra-28. Insertion site verified by PCR. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites."
Proper citation: RRID:WB-STRAIN:WBStrain00033336 Copy
http://www.wormbase.org/db/get?name=WBStrain00033338
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00005043(sra-17)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00005043(sra-17), WBGene00006789(unc-54)
Availability: available
Source References: PMID:34429473
Synonyms: sra-17(ve511[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II.
Alternate IDs: WB-STRAIN:RG3011, CGC_RG3011
Notes: Homozygous viable. Deletion of 1733 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CGAGCTCCTCGAGAGCTTGAAATGCGCCTC ; Right flanking sequence: ATTGGAGTGATGACATCAATGTACGGAGAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 1733 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: CGAGCTCCTCGAGAGCTTGAAATGCGCCTC ; Right flanking sequence: ATTGGAGTGATGACATCAATGTACGGAGAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: Emily Lorenz-Mueller"|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of sra-17. Insertion site verified by PCR. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: CGAGCTCCTCGAGAGCTTGAAATGCGCCTC Right flanking sequence: ATTGGAGTGATGACATCAATGTACGGAGAT"|"WBStrain provided so WBPaper00061836 paper added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00033338 Copy
http://www.wormbase.org/db/get?name=WBStrain00033339
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00005053(sra-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00005053(sra-27), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: sra-27(ve512[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II.
Alternate IDs: WB-STRAIN:RG3012, CGC_RG3012
Notes: Homozygous viable. Deletion of 1310 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ctcttagtattattattatttgttccccct ; Right flanking sequence: GGAGGAGTATATGGAAATCTATCAATTCCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 1310 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: ctcttagtattattattatttgttccccct ; Right flanking sequence: GGAGGAGTATATGGAAATCTATCAATTCCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: Emily Lorenz-Mueller"|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of sra-27. Insertion site verified by PCR. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: ctcttagtattattattatttgttccccct Right flanking sequence: GGAGGAGTATATGGAAATCTATCAATTCCT"
Proper citation: RRID:WB-STRAIN:WBStrain00033339 Copy
http://www.wormbase.org/db/get?name=WBStrain00033330
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00005060(sra-34)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00005060(sra-34), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: sra-34(ve500[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II.
Alternate IDs: WB-STRAIN:RG3000, CGC_RG3000
Notes: Homozygous viable. Deletion of 1822 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GAATTAATACAAACAACAGGAGCTGGAACA ; Right flanking sequence: gaaggtattgaataaaacgcggaagttcta. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 1822 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: GAATTAATACAAACAACAGGAGCTGGAACA ; Right flanking sequence: gaaggtattgaataaaacgcggaagttcta. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of sra-34. Insertion site verified by PCR. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: GAATTAATACAAACAACAGGAGCTGGAACA Right flanking sequence: gaaggtattgaataaaacgcggaagttcta"
Proper citation: RRID:WB-STRAIN:WBStrain00033330 Copy
http://www.wormbase.org/db/get?name=WBStrain00033334
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00005030(sra-4)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00005030(sra-4), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: sra-4(ve504[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II.
Alternate IDs: WB-STRAIN:RG3004, CGC_RG3004
Notes: Homozygous viable. Deletion of 1294 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ggtgtgaaagattttaaataaacaccctcg ; Right flanking sequence: CAAGGACATtctttaaaagtaaaaagaacc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 1294 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: ggtgtgaaagattttaaataaacaccctcg ; Right flanking sequence: CAAGGACATtctttaaaagtaaaaagaacc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: Emily Lorenz-Mueller"|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of sra-4. Insertion site verified by PCR. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: ggtgtgaaagattttaaataaacaccctcg Right flanking sequence: CAAGGACATtctttaaaagtaaaaagaacc"
Proper citation: RRID:WB-STRAIN:WBStrain00033334 Copy
http://www.wormbase.org/db/get?name=WBStrain00033335
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00005057(sra-31)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00005057(sra-31), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: sra-31(ve506[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II.
Alternate IDs: WB-STRAIN:RG3006, CGC_RG3006
Notes: Homozygous viable. Deletion of 1008 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: gttttattttttaaatacCGTCATAAAAGC ; Right flanking sequence: CCAGGAATTTCCATtttagctgatatagat. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 1008 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: gttttattttttaaatacCGTCATAAAAGC ; Right flanking sequence: CCAGGAATTTCCATtttagctgatatagat. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of sra-31. Insertion site verified by PCR. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites."
Proper citation: RRID:WB-STRAIN:WBStrain00033335 Copy
http://www.wormbase.org/db/get?name=WBStrain00033425
Source Database: WormBase (WB)
Affected Genes: WBGene00016539(madd-2)
Genomic Alteration: WBGene00016539(madd-2)
Availability: available
Source References: EMPTY
Synonyms: madd-2(tr103) V.
Alternate IDs: WB-STRAIN:RP828, CGC_RP828
Notes: Midline-oriented migration defects including muscle arm extension and HSN, AVM, and PVM axon guidance defects. Reference: Alexander M, et al. Dev Cell. 2010 Jun 15;18(6):961-72.
Proper citation: RRID:WB-STRAIN:WBStrain00033425 Copy
http://www.wormbase.org/db/get?name=WBStrain00033426
Source Database: WormBase (WB)
Affected Genes: WBGene00016539(madd-2)
Genomic Alteration: WBGene00016539(madd-2)
Availability: available
Source References: EMPTY
Synonyms: madd-2(tr129) V.
Alternate IDs: WB-STRAIN:RP1416, CGC_RP1416
Notes: Midline-oriented migration defects including muscle arm extension and HSN, AVM, and PVM axon guidance defects. Reference: Alexander M, et al. Dev Cell. 2010 Jun 15;18(6):961-72.
Proper citation: RRID:WB-STRAIN:WBStrain00033426 Copy
http://www.wormbase.org/db/get?name=WBStrain00033427
Source Database: WormBase (WB)
Affected Genes: WBGene00003225(mev-1)
Genomic Alteration: WBGene00003225(mev-1)
Availability: unknown
Source References: PMID:26108372, PMID:38719808
Synonyms: mev-1(tr355) III.
Alternate IDs: WB-STRAIN:RP2635
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00033427 Copy
http://www.wormbase.org/db/get?name=WBStrain00033428
Source Database: WormBase (WB)
Affected Genes: WBGene00006433(sdhb-1)
Genomic Alteration: WBGene00006433(sdhb-1)
Availability: unknown
Source References: PMID:26108372
Synonyms: sdhb-1(tr356) II.
Alternate IDs: WB-STRAIN:RP2636
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00033428 Copy
http://www.wormbase.org/db/get?name=WBStrain00033429
Source Database: WormBase (WB)
Affected Genes: WBGene00003225(mev-1)
Genomic Alteration: WBGene00003225(mev-1)
Availability: available
Source References: PMID:26108372
Synonyms: mev-1(tr357) III.
Alternate IDs: WB-STRAIN:RP2637, CGC_RP2637
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00033429 Copy
http://www.wormbase.org/db/get?name=WBStrain00033420
Source Database: WormBase (WB)
Affected Genes: WBGene00001187(egl-19)
Genomic Alteration: WBGene00001187(egl-19)
Availability: available
Source References: EMPTY
Synonyms: egl-19(tr69) IV.
Alternate IDs: WB-STRAIN:RP582, CGC_RP582
Notes: Made_by: T Kwok/P Roy|"Nemadipine-A resistant."
Proper citation: RRID:WB-STRAIN:WBStrain00033420 Copy
http://www.wormbase.org/db/get?name=WBStrain00033422
Source Database: WormBase (WB)
Affected Genes: WBGene00001187(egl-19)
Genomic Alteration: WBGene00001187(egl-19)
Availability: available
Source References: EMPTY
Synonyms: egl-19(tr71) IV.
Alternate IDs: WB-STRAIN:RP584, CGC_RP584
Notes: Made_by: Kwok/Turnbull/P Roy|"Nemadipine-A resistant."
Proper citation: RRID:WB-STRAIN:WBStrain00033422 Copy
http://www.wormbase.org/db/get?name=WBStrain00033423
Source Database: WormBase (WB)
Affected Genes: WBGene00001187(egl-19)
Genomic Alteration: WBGene00001187(egl-19)
Availability: available
Source References: EMPTY
Synonyms: egl-19(tr72) IV.
Alternate IDs: WB-STRAIN:RP585, CGC_RP585
Notes: Made_by: T Kwok/P Roy|"Myotonic. Nemadipine-A resistant."
Proper citation: RRID:WB-STRAIN:WBStrain00033423 Copy
http://www.wormbase.org/db/get?name=WBStrain00033437
Source Database: WormBase (WB)
Affected Genes: WBGene00009353(sdhd-1)
Genomic Alteration: WBGene00009353(sdhd-1)
Availability: unknown
Source References: PMID:26108372
Synonyms: sdhd-1(tr391) II.
Alternate IDs: WB-STRAIN:RP2672
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00033437 Copy
http://www.wormbase.org/db/get?name=WBStrain00033438
Source Database: WormBase (WB)
Affected Genes: WBGene00003225(mev-1)
Genomic Alteration: WBGene00003225(mev-1)
Availability: unknown
Source References: PMID:26108372
Synonyms: mev-1(tr392) III.
Alternate IDs: WB-STRAIN:RP2673
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00033438 Copy
http://www.wormbase.org/db/get?name=WBStrain00033439
Source Database: WormBase (WB)
Affected Genes: WBGene00003225(mev-1)
Genomic Alteration: WBGene00003225(mev-1)
Availability: unknown
Source References: PMID:26108372
Synonyms: mev-1(tr393) III.
Alternate IDs: WB-STRAIN:RP2674
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00033439 Copy
http://www.wormbase.org/db/get?name=WBStrain00033430
Source Database: WormBase (WB)
Affected Genes: WBGene00003225(mev-1)
Genomic Alteration: WBGene00003225(mev-1)
Availability: available
Source References: PMID:26108372
Synonyms: mev-1(tr359) III.
Alternate IDs: WB-STRAIN:RP2639, CGC_RP2639
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00033430 Copy
http://www.wormbase.org/db/get?name=WBStrain00033431
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:26108372
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:RP2661
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00033431 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the T1D Resources search. From here you can search through a compilation of resources used by T1D and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that T1D has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on T1D then you can log in from here to get additional features in T1D such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into T1D you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within T1D that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.