Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
SD-Apoetm1(APOE*)Sage Resource Report Resource Website |
RRID:RGD_12902616 | Rattus norvegicus | These rats were created using CrISPR/Cas9 system to replace the Rat ApoE gene with the Human 4 allele APOE gene Horizon Discovery | 12902616 | mutant | Rat Genome Database (RGD) | RGD | Live Animals (as of 2017-05-09) | 12902616 | 2026-09-05 06:52:38 | 0 | |||||
|
SS-Tg(Slc12a1-Ncf2-2A-Luc)-Ncf2em1Mcwi Resource Report Resource Website |
RRID:RGD_13207513 | Rattus norvegicus | This is compound transgenic/mutant rat strain derived from the breeding of SS-Tg(Slc12a1-Ncf2-2A-Luc) and SS-Ncf2em1Mcwi. Contact MCW rat distribution at [email protected] | 13207513 | mutant | Rat Genome Database (RGD) | RGD | Cryorecovery (as of 2017-08-03) | 13207513 | 2026-09-05 06:52:38 | 0 | |||||
|
SS-Ptgs2em1Mcwi Resource Report Resource Website |
RRID:RGD_13208842 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a mutation in the Ptgs2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 53-bp deletion of exon 4 in the Ptgs2 gene. Contact MCW rat distribution at [email protected] | 13208842 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2021-11-03) | 13208842 | 2026-09-05 06:52:38 | 0 | |||||
|
SS-Adamts16em1Bj Resource Report Resource Website |
RRID:RGD_13437612 | Rattus norvegicus | This strain was produced by injecting ZFNs target sequence CCGCGGTTGCTTTGCGCTCTGGGTGCTGTTGCTGGCGCA into Dahl S rat eggs as . The resulting mutation is a 17-bp deletion of the sequence gctctgggtgctgttgc in exon 1. | 13437612 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 13437612 | 2026-09-05 06:52:38 | 0 | |||||
|
WKY-Tph1em1Mcwi Resource Report Resource Website |
RRID:RGD_13207595 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a mutation in the Tph1 gene of WKY/NCrl rat embryos. The resulting mutation is a 1-bp deletion in the exon 4 of the Tph1 gene. Contact MCW rat distribution at [email protected] | 13207595 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2021-11-03) | 13207595 | 2026-09-05 06:52:38 | 0 | |||||
|
SHR-Hspa1em1Mcwi Resource Report Resource Website |
RRID:RGD_13207518 | Rattus norvegicus | CRISPR/SpCas9 was used to create indel mutations in Hspa1a, Hspa1b, Hspa1L in SHR/NCrl embryos. Contact MCW rat distribution at [email protected] | 13207518 | mutant | Rat Genome Database (RGD) | RGD | Cryorecovery (as of 2018-05-01) | 13207518 | 2026-09-05 06:52:37 | 0 | |||||
|
SD-ROSA26em1(Epac-SH187)Mcwi Resource Report Resource Website |
RRID:RGD_13207514 | Rattus norvegicus | CRISPR/SpCas9 was used to knock in the Epac-SH187, Epac-based FRET sensor into the Rosa26 locus under the control of the endogenous promoter using an Ad2 splice acceptor. Contact MCW rat distribution at [email protected] | 13207514 | mutant | Rat Genome Database (RGD) | RGD | Live Animals (as of 2017-08-03) | 13207514 | 2026-09-05 06:52:38 | 0 | |||||
|
SD-Cdkn1bwe Resource Report Resource Website |
RRID:RGD_12910940 | Rattus norvegicus | The multiple endocrine neoplasia (MEN)-like phenotype was initially identified in a Sprague Dawley rat-breeding colony and subsequently maintained by matings between affected and nonaffected littermates. Because cataracts are the first visible sign of the phenotype it was provisionally designated as "Sprague Dawley white eye." The abbreviation SDwe is used to denote animals expressing the mutant phenotype. | 12910940 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 12910940 | 2026-09-05 06:52:38 | 0 | |||||
|
SD-Cd55em4Mcwi Resource Report Resource Website |
RRID:RGD_13207494 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a 22-bp deletion of exon 2 in the rat Cd55 gene of Crl:SD embryos. Contact MCW rat distribution at [email protected] | 13207494 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2021-11-03) | 13207494 | 2026-09-05 06:52:38 | 0 | |||||
|
SD-Slc22a8em1Sage Resource Report Resource Website |
RRID:RGD_12904893 | Rattus norvegicus | This ZFN model carries the knockout of the rat Slc22a8. Horizon Discovery | 12904893 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Embryo (as of 2017-05-24) | 12904893 | 2026-09-05 06:52:38 | 0 | |||||
|
SS.BN-(D13Hmgc1048-D13Hmgc1050)-Pappa2em5Mcwi Resource Report Resource Website |
RRID:RGD_13204788 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a 60-bp deletion in exon 2 of the rat Pappa2 gene of SS.BN-(D13Hmgc1048-D13Hmgc1050)/Mcwi rat embryos. Contact MCW rat distribution at [email protected] | 13204788 | mutant | Rat Genome Database (RGD) | RGD | Live Animals; Cryopreserved Sperm (as of 2021-11-03) | 13204788 | 2026-09-05 06:52:38 | 0 | |||||
|
SD-Cacna1f csnb Resource Report Resource Website |
RRID:RGD_13782371 | Rattus norvegicus | A naturally-occurring mutation in Cacna1f was identified in a male Sprague Dawley rat with the phenotype of congenital stationary night blindness.Sequence analysis revealed a point mutation of C to T at position 2941, which changes codon 981 from arginine (CGA) to a stop codon (TGA). This R981Stop point mutation was predicted to lead to a version of protein shortened by a total of 999 amino acids, and missing the C-terminal and, in particular, part of the third and all of the fourth ion transport domains. | 13782371 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 13782371 | 2026-09-05 06:52:39 | 0 | |||||
|
SD-Abcb1aem1Sage Abcg2em1Sage Resource Report Resource Website |
RRID:RGD_12904684 | Rattus norvegicus | This model contains two knockout genes, the 20-bp deletion within rat Abcba1 and the 588-bp deletion within rat Abcg2 gene. Horizon Discovery | 12904684 | mutant | Rat Genome Database (RGD) | RGD | Live Animals (as of 2017-05-17) | 12904684 | 2026-09-05 06:52:39 | 0 | |||||
|
SD-Abcc2em1Sage Resource Report Resource Website |
RRID:RGD_12904685 | Rattus norvegicus | This ZFN model contains a biallelic 726 bp deletion within the Abcc2 gene. Animals exhibit decreased transport of endogenous glutathione and hyperbilirubinemia. The homozygous knockout rats display total loss of protein via Western blot. Horizon Discovery | 12904685 | mutant | Rat Genome Database (RGD) | RGD | Live Animals (as of 2017-05-17) | 12904685 | 2026-09-05 06:52:39 | 0 | |||||
|
SD-Dmdem1Ang Resource Report Resource Website |
RRID:RGD_12880037 | Rattus norvegicus | This mutant strain was generated by injecting TALEN targeting exon23 of rat Dmd into Crl:SD embryo. The resulting mutant is a 11 bp-deletion in exon 23 leading to a +1 grame shift and premature stop codon 81 bp after the mutation. | 12880037 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 12880037 | 2026-09-05 06:52:39 | 0 | |||||
|
SD-Apoeem1Sage Resource Report Resource Website |
RRID:RGD_12880021 | Rattus norvegicus | The mutant rat strain was produced by injecting zinc endonuclease targeting the exon 3 of rat Apoe into Sprague Dawley embryos. This mutant rat has a 16-bp deletion in the gene and resulted in complete loss of Apoe protein in homozygotes. Horizon Discovery | 12880021 | mutant | Rat Genome Database (RGD) | RGD | Live Animals (as of 2017-05-01) | 12880021 | 2026-09-05 06:52:39 | 0 | |||||
|
WKY-Cyp2j4em1Sage/Tja Resource Report Resource Website 1+ mentions |
RRID:RGD_12904679 | Rattus norvegicus | ZFN system was used to introduce a 25-bp deletion mutation in the exon 4 of Cyp2j4 gene of WKY/NCrl rat embryos. This deletion results in premature stop of protein translation. | 12904679 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 12904679 | 2026-09-05 06:52:38 | 1 | |||||
|
F344-Hsd11b2em1Jmul-/- Resource Report Resource Website |
RRID:RGD_13800556 | Rattus norvegicus | The ZFN system targeting exon 2 of Hsd11b2 gene was injected into the F344/IcoCrl embryos to induce a 123-bp deletion removing the 3' end of exon 2 and the first 16-bp of intron B and create a premature stop coden TAG. | 13800556 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 13800556 | 2026-09-05 06:52:39 | 0 | |||||
|
SD-Mmp12em2Soar Resource Report Resource Website |
RRID:RGD_12910505 | Rattus norvegicus | TALEN mediated 607 bp deletion that includes exon 2 of the Mmp12 gene, resulting in a frameshift and premature stop codon | 12910505 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 12910505 | 2026-09-05 06:52:38 | 0 | |||||
|
SD-Abcg2em1Sage Resource Report Resource Website |
RRID:RGD_12904063 | Rattus norvegicus | This ZFN model carries a 588-bp deletion within Abcg2 gene. Homozygous knockouts display total loss of protein via Western blot Horizon Discovery | 12904063 | mutant | Rat Genome Database (RGD) | RGD | Live Animals (as of 2017-05-16) | 12904063 | 2026-09-05 06:52:39 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the T1D Resources search. From here you can search through a compilation of resources used by T1D and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that T1D has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on T1D then you can log in from here to get additional features in T1D such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into T1D you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
