Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: CMYC
Vector Backbone Description: Backbone Size:5169; Vector Backbone:pBABE puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24717435
Comments: The mutations found during the QC process have no functional consequence.
Proper citation: RRID:Addgene_53178 Copy
Species: Mus musculus
Genetic Insert: The Arl13b noncilium targeting sequence-EGFP-TurboID
Vector Backbone Description: Backbone Size:5382; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38664376
Proper citation: RRID:Addgene_248196 Copy
Species: Mus musculus
Genetic Insert: Microexon E35a
Vector Backbone Description: Vector Backbone:pCAGGS; Vector Types:Mammalian Expression, Other, TOPO TA vector; Bacterial Resistance:Ampicillin
Comments: Microexon E35a sequence: gagacagagtcagatcaagatgatgag
Proper citation: RRID:Addgene_238353 Copy
Species: Mus musculus
Genetic Insert: Gad1
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_225345 Copy
Species: Mus musculus
Genetic Insert: Slc17A7
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV, Cre/Lox, CRISPR; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_225346 Copy
Species: Mus musculus
Genetic Insert: shErbb4
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39405910
Proper citation: RRID:Addgene_223310 Copy
Species: Mus musculus
Genetic Insert: Nlgn1 without PBM - CTEV
Vector Backbone Description: Vector Backbone:pTag4C; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39405910
Proper citation: RRID:Addgene_223307 Copy
Species: Mus musculus
Genetic Insert: Nlgn1
Vector Backbone Description: Vector Backbone:pTag4C; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:39405910
Proper citation: RRID:Addgene_223305 Copy
Species: Mus musculus
Genetic Insert: shErbb4
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:39405910
Proper citation: RRID:Addgene_223309 Copy
Species: Mus musculus
Genetic Insert: anti-S100B (human) heavy chain
Vector Backbone Description: Vector Backbone:pcDNA3.4; Vector Types:Mammalian Expression, Affinity Reagent/ Antibody; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_182908 Copy
Species: Mus musculus
Genetic Insert: anti-S100B (human) light chain
Vector Backbone Description: Vector Backbone:pcDNA3.4; Vector Types:Mammalian Expression, Affinity Reagent/ Antibody; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_182905 Copy
Species: Mus musculus
Genetic Insert: anti-S100B (human) heavy chain
Vector Backbone Description: Vector Backbone:pcDNA3.4; Vector Types:Mammalian Expression, Affinity Reagent/ Antibody; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_182904 Copy
Species: Mus musculus
Genetic Insert: anti-S100B (human) heavy chain
Vector Backbone Description: Vector Backbone:pcDNA3.4; Vector Types:Mammalian Expression, Affinity Reagent/ Antibody; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_182912 Copy
Species: Mus musculus
Genetic Insert: anti-S100B (human) light chain
Vector Backbone Description: Vector Backbone:pcDNA3.4; Vector Types:Mammalian Expression, Affinity Reagent/ Antibody; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_182913 Copy
Species: Mus musculus
Genetic Insert: Opa1-K301A
Vector Backbone Description: Vector Backbone:MSCV; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_191945 Copy
Species: Mus musculus
Genetic Insert: Kras
Vector Backbone Description: Backbone Size:5086; Vector Backbone:pBabePuro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36069770
Proper citation: RRID:Addgene_206865 Copy
Species: Mus musculus
Genetic Insert: Pdzd8
Vector Backbone Description: Vector Backbone:pCAG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40246839
Proper citation: RRID:Addgene_253954 Copy
Species: Mus musculus
Genetic Insert: Pvalb-2A-Flpo
Vector Backbone Description: Backbone Size:2682; Vector Backbone:pUC57; Vector Types:Recombinase-mediated cassette exchange using Flp recombinase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25741722
Proper citation: RRID:Addgene_61572 Copy
Species: Mus musculus
Genetic Insert: CD47
Vector Backbone Description: Backbone Marker:Jeng-Shin Lee, Harvard University; Backbone Size:6079; Vector Backbone:AAV-MCS8; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34197341
Proper citation: RRID:Addgene_168479 Copy
Species: Mus musculus
Genetic Insert: Ribo-GCaMP8m
Vector Backbone Description: Backbone Size:2868; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:36739289
Proper citation: RRID:Addgene_167574 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the T1D Resources search. From here you can search through a compilation of resources used by T1D and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that T1D has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on T1D then you can log in from here to get additional features in T1D such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into T1D you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within T1D that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.