Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
PP364 Resource Report Resource Website |
RRID:Addgene_104945 | hGH | Bleocin (Zeocin) | PMID:29311542 | Vector Backbone:PP117; Vector Types:; Bacterial Resistance:Bleocin (Zeocin) | 2026-09-01 09:10:28 | 0 | |||
|
JC021 Resource Report Resource Website |
RRID:Addgene_104944 | G-CSF | Bleocin (Zeocin) | PMID:29311542 | Vector Backbone:PP117; Vector Types:; Bacterial Resistance:Bleocin (Zeocin) | 2026-09-01 09:10:28 | 0 | |||
|
JC101 Resource Report Resource Website |
RRID:Addgene_104952 | GFP, mCherry, and CFP | Bleocin (Zeocin) | PMID:29311542 | Vector Backbone:PP117; Vector Types:; Bacterial Resistance:Bleocin (Zeocin) | 2026-09-01 09:10:28 | 0 | |||
|
pFUSEss-CHIg-mG1_CH2-3 Resource Report Resource Website |
RRID:Addgene_105851 | IgG1 heavy chain, IgG3 heavy chain | Mus musculus | Bleocin (Zeocin) | PMID:29875771 | Backbone Marker:Invivogen; Backbone Size:4483; Vector Backbone:pFUSEss-CHIg-mG1 (modified); Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | hybrid heavy chain of mouse IgG1 with CH2 derived from mouse IgG3 | 2026-09-01 09:10:43 | 0 | |
|
pFUSEss-CHIg-mG1_CH2charge Resource Report Resource Website |
RRID:Addgene_105852 | IgG1 heavy chain | Mus musculus | Bleocin (Zeocin) | PMID:29875771 | Backbone Marker:Invivogen; Backbone Size:4474; Vector Backbone:pFUSEss-CHIg-mG1 (modified); Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | mutated heavy chain of mouse IgG1, muatations: Gln274His; Val282Lys; Asn315Arg; Ala326Lys; | 2026-09-01 09:10:43 | 0 | |
|
pFUSEss-CHIg-mG1_CH1h-3 Resource Report Resource Website |
RRID:Addgene_105850 | IgG1 heavy chain, IgG3 heavy chain | Mus musculus | Bleocin (Zeocin) | PMID:29875771 | Backbone Marker:Invivogen; Backbone Size:4483; Vector Backbone:pFUSEss-CHIg-mG1 (modified); Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | hybrid heavy chain of mouse IgG1 with CH1 and hinge derived from mouse IgG3 | 2026-09-01 09:10:43 | 0 | |
|
pFUSEss-CHIg-mG3_CH2charge Resource Report Resource Website |
RRID:Addgene_105858 | IgG3 heavy chain | Mus musculus | Bleocin (Zeocin) | PMID:29875771 | Backbone Marker:Invivogen; Backbone Size:4483; Vector Backbone:pFUSEss-CHIg-mG3 (modified); Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | mutated heavy chain of mouse IgG3, muatations: His274Gln; Lys282Val; Arg315Asn; Lys326Ala; | 2026-09-01 09:10:44 | 0 | |
|
pFUSEss-CHIg-mG3_CH1h-1 Resource Report Resource Website |
RRID:Addgene_105856 | IgG1, IgG3 | Mus musculus | Bleocin (Zeocin) | PMID:29875771 | Backbone Marker:Invivogen; Backbone Size:4474; Vector Backbone:pFUSEss-CHIg-mG3 (modified); Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | hybrid heavy chain of mouse IgG3 with CH1 and hinge derived from mouse IgG1 | 2026-09-01 09:10:43 | 0 | |
|
pFUSEss-CHIg-mG1_h-3 Resource Report Resource Website |
RRID:Addgene_105854 | IgG1 heavy chain, IgG3 heavy chain | Mus musculus | Bleocin (Zeocin) | PMID:29875771 | Backbone Marker:Invivogen; Backbone Size:4483; Vector Backbone:pFUSEss-CHIg-mG1 (modified); Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | hybrid heavy chain of mouse IgG1 with hinge derived from mouse IgG3 | 2026-09-01 09:10:43 | 0 | |
|
pFUSEss-CHIg-mG3_Lys322Arg Resource Report Resource Website |
RRID:Addgene_105862 | IgG3 heavy chain | Mus musculus | Bleocin (Zeocin) | PMID:29875771 | Backbone Marker:Invivogen; Backbone Size:4483; Vector Backbone:pFUSEss-CHIg-mG3; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | Lys322Arg in constant region of IgG1 heavy chain | 2026-09-01 09:10:44 | 0 | |
|
pFUSEss-CHIg-mG3_F(ab')2 Resource Report Resource Website |
RRID:Addgene_105860 | IgG3 F(ab')2 | Mus musculus | Bleocin (Zeocin) | PMID:29875771 | Backbone Marker:Invivogen; Backbone Size:4549; Vector Backbone:pFUSEss-CHIg-mG3 (modified); Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | 2026-09-01 09:10:44 | 0 | ||
|
pFUSEss-CHIg-mG1_Arg322Lys Resource Report Resource Website |
RRID:Addgene_105849 | IgG1 heavy chain | Mus musculus | Bleocin (Zeocin) | PMID:29875771 | Backbone Marker:Invivogen; Backbone Size:4474; Vector Backbone:pFUSEss-CHIg-mG1; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | Arg322Lys in constant region of IgG1 heavy chain | 2026-09-01 09:10:43 | 0 | |
|
pfwB Resource Report Resource Website 1+ mentions |
RRID:Addgene_37329 | GFP | Aequorea victoria | Bleocin (Zeocin) | PMID:15709003 | Vector Backbone:custom; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | 2026-09-01 09:53:43 | 4 | ||
|
pCAG-p21_T145A/S146A Resource Report Resource Website |
RRID:Addgene_42623 | p21 | Homo sapiens | Bleocin (Zeocin) | PMID:23299246 | Backbone Marker:Invivogen; Vector Backbone:pCAG; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | T145A/S146A | 2026-09-01 09:54:41 | 0 | |
|
pSV HA eIF2beta (Pro110-113) Resource Report Resource Website |
RRID:Addgene_45899 | eIF2beta | Mus musculus | Bleocin (Zeocin) | PMID:11959995 | Two fragments were PCR amplified from GST-eIF2beta (Addgene plasmid 45900) and ligated together with vector to incorporate deletion. Xba1 site is used to ligate the 2 parts of eIF2beta. | Backbone Marker:Invitrogen; Backbone Size:3500; Vector Backbone:pZeoSV2; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | P110A, P113A | 2026-09-01 09:55:23 | 0 |
|
pCoofy42 Resource Report Resource Website |
RRID:Addgene_55190 | Bleocin (Zeocin) | PMID:23410102 | C-terminal tags are separated by stop codons. Depending on the LP2 primer used in SLIC, the desired C-terminal tag(s) can be fused to the target gene. Use the one of the following linearization primers pairs for SLIC cloning. Choose one LP1 forward vector primer and one LP2 reverse vector primer: LP1 forward vector primer: SLIC Primer (3C site) 5' GGGCCCCTGGAACAGAACTTCCAG 3' LP2 - select an LP2 primer below depending on which C-terminal tags you want to include fused to your gene of interest: none SLIC Primer 5' CGCCATTAACCTGATGTTCTGGGG 3' 10His- SLIC Primer 5`GAGCATCATCATCATCACCAC 3' StrepOne - SLIC Primer 5`AGCGCTTGGAGCCACCCGCAG 3' S-Tag - SLIC Primer 5`AAAGAAACCGCTGCTGCTAAATTCG 3' HPC4 - SLIC Primer 5`GAGGACCAGGTGGACCCCCGG 3' Æ54CPD - SLIC Primer 5`GGCAGCGGCAAGATCCTGCAC 3' Test each preparation of the plasmid by transforming it into non-resistant cells (ex. DH5a) to ensure negative selection by ccdB kills all the transformed cells as expected. | Backbone Marker:Life Technologies; Backbone Size:4871; Vector Backbone:pPICZalpha C; Vector Types:Yeast Expression; Bacterial Resistance:Bleocin (Zeocin) | 2026-09-01 09:57:22 | 0 | |||
|
M-tdTom-SP Resource Report Resource Website 1+ mentions |
RRID:Addgene_48677 | TAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, SP-PAM, and tdTomato reporter. Compatible with S. pyogenes Cas9 | Synthetic | Bleocin (Zeocin) | PMID:24076762 | Vector Backbone:Unknown; Vector Types:CRISPR; Bacterial Resistance:Bleocin (Zeocin) | 2026-09-01 09:56:00 | 2 | ||
|
p8RwB Resource Report Resource Website 1+ mentions |
RRID:Addgene_48733 | dsRed-Express | Discosoma sp | Bleocin (Zeocin) | PMID:17603495 | This plasmid is nearly identical to pRwB (http://www.addgene.org/48734), except that it contains a 2kb stuffer region to bring its size closer to the ~8kb native papillomavirus genome. For more information on using this plasmid, please see the following website: http://home.ccr.cancer.gov/Lco/target.htm | Vector Backbone:custom; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | 2026-09-01 09:56:00 | 2 | |
|
pRwB Resource Report Resource Website 1+ mentions |
RRID:Addgene_48734 | dsRed-Express | Discosoma sp | Bleocin (Zeocin) | PMID:19073722 | Note that this plasmid is substantially smaller than the ~8kb native papillomavirus genome. There is a second version of this plasmid with a 2kb stuffer region that is available here: http://www.addgene.org/48733 . Further information can be found here: http://home.ccr.cancer.gov/Lco/target.htm | Vector Backbone:custom; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | 2026-09-01 09:56:00 | 1 | |
|
DH10B-M.XmnI Resource Report Resource Website |
RRID:Addgene_114269 | Bleocin (Zeocin) | PMID:29986052 | See Supplemental Documents for strain verification protocols and data. | Vector Backbone:None; Vector Types:; Bacterial Resistance:Bleocin (Zeocin) | 2026-09-01 09:13:02 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the T1D Resources search. From here you can search through a compilation of resources used by T1D and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that T1D has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on T1D then you can log in from here to get additional features in T1D such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into T1D you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
