Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: HRPT2 136X
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15632063
Comments: Author has deposited insert sequence. Click on "sequence" to view. Cloned using the following primers 5' CGGGATCCATGGCGGACGTGCTTAGCGT 3' and 5' CCGCTCGAGCTATGCTTCTGCTAAAACTTC 3' and ligated into pcDNA3 HRPT2 that had been digested with BamHI & XhoI (which removes full-length HRPT2, but leaves the flag tag at the N-terminus. See plasmid 11048 to learn how pcDNA3 HRPT2 was constructed).
Proper citation: RRID:Addgene_11049 Copy
Species: Homo sapiens
Genetic Insert: HRPT2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15632063
Comments: Author has deposited insert sequence. Click on "sequence" to view. Cloned using the following primers 5' CGGAATTCGGATCCACCATGGATTACAAGGATGACGACGATAAGGTCGACATGGCGGACGTGCTTAGCGT 3' and 5' CCGCTCGAGTCAGAATCTCAAGTGCGATTTATGCTT 3'
Proper citation: RRID:Addgene_11048 Copy
Species: Xenopus laevis
Genetic Insert: TRPS1 delN delC119 mut
Vector Backbone Description: Backbone Size:4133; Vector Backbone:pCS105; Vector Types:xenopus, mammalian, avian, and zebrafish; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11285235
Comments: Can be expressed in cos cells, gives the correct sized product by in-vitro tranlation and can be expressed in xenopus embryos.
Proper citation: RRID:Addgene_11045 Copy
Species: Xenopus laevis
Genetic Insert: TRPS1 mut
Vector Backbone Description: Backbone Size:4133; Vector Backbone:pCS105; Vector Types:mammalian, avian, and zebrafish; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11285235
Comments: Can be expressed in cos cells, does not give correct sized product by in-vitro translation, and cannot be expressed in xenopus embryos.
Proper citation: RRID:Addgene_11047 Copy
Species: Homo sapiens
Genetic Insert: SOX4
Vector Backbone Description: Backbone Marker:William Sellers; Vector Backbone:pcDNA3-Flag-FKHR; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16618720
Proper citation: RRID:Addgene_110360 Copy
Species: Xenopus laevis
Genetic Insert: TRPS1
Vector Backbone Description: Backbone Size:4133; Vector Backbone:pCS105; Vector Types:mammalian, avian, and zebrafish; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11285235
Proper citation: RRID:Addgene_11046 Copy
Species: Homo sapiens
Genetic Insert: HOXC6
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pcDNA3-HISA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15637592
Proper citation: RRID:Addgene_110365 Copy
Species: Xenopus laevis
Genetic Insert: TRPS1
Vector Backbone Description: Backbone Size:4133; Vector Backbone:pCS105; Vector Types:mammalian, avian, and zebrafish; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11285235
Proper citation: RRID:Addgene_11041 Copy
Species: Homo sapiens
Genetic Insert: HOXC6
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pcDNA3-HISA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15637592
Proper citation: RRID:Addgene_110366 Copy
Species: Mus musculus
Genetic Insert: TRPS1 mut
Vector Backbone Description: Backbone Size:4133; Vector Backbone:pCS105; Vector Types:xenopus, mammalian, avian, and zebrafish; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11285235
Comments: Full coding + UTR of mTRPS1. Can be expressed in cos cell, xenopus embryos, and in vitro translation.
Proper citation: RRID:Addgene_11040 Copy
Vector Backbone Description: Backbone Marker:#42230; Backbone Size:8506; Vector Backbone:pX330-U6-Chimeric_BB-CBh-hSpCas9; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Comments: pX330 with puromycin resistance
For plasmid usage, please see the associated publication (Cong et al. Science. 2013, PMID: 23287718), as well as Ran et al. Nat Protoc. 2013, PMID: 24157548.
For more information on Zhang Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/zhang/
Proper citation: RRID:Addgene_110403 Copy
Species: Homo sapiens
Genetic Insert: GLS glutaminase
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:6278; Vector Backbone:psiCHECK2; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_110401 Copy
Species: Homo sapiens
Genetic Insert: GLS glutaminase
Vector Backbone Description: Backbone Marker:#50005; Backbone Size:2686; Vector Backbone:pUC19; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Comments: Homology arm for C-Terminal knock-in at stop codon of GLS' KGA isoform. Just mKO2 knock-in.
Construction order:
GLS 1kb 5' Homology Arm: SacI-BamHI;
GLS 1kb 3' Homology Arm BamHI-SalI;
BglII-BamHI mKO2
System options:
sgRNA:
pX330.puro sgRNA KGA Stop1 (Addgene #110405)
Homology arms:
pUC19 KGA HA5'-mKO2-3' (Addgene #110406)
pUC19 KGA HA5'-mKO2-P2A-3' (Addgene #110407)
pUC19 KGA HA5'-mKO2-P2A-Zeo-3' (Addgene #110408)
Proper citation: RRID:Addgene_110406 Copy
Vector Backbone Description: Backbone Marker:#42230; Backbone Size:8506; Vector Backbone:pX330-U6-Chimeric_BB-CBh-hSpCas9; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Comments: pX330 with puromycin resistance
For plasmid usage, please see the associated publication (Cong et al. Science. 2013, PMID: 23287718), as well as Ran et al. Nat Protoc. 2013, PMID: 24157548.
For more information on Zhang Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/zhang/
Proper citation: RRID:Addgene_110404 Copy
Species: Homo sapiens
Genetic Insert: GLS glutaminase
Vector Backbone Description: Backbone Marker:#110403; Backbone Size:9906; Vector Backbone:pX330.puro; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Comments: sgRNA for GLS exon 19 (KGA isoform stop codon), intended to perform C-Terminal knock-in using pX330 with puromycin resistance.
System options:
sgRNA:
pX330.puro sgRNA KGA Stop1 (Addgene #110405)
Homology arms:
pUC19 KGA HA5'-mKO2-3' (Addgene #110406)
pUC19 KGA HA5'-mKO2-P2A-3' (Addgene #110407)
pUC19 KGA HA5'-mKO2-P2A-Zeo-3' (Addgene #110408)
Proper citation: RRID:Addgene_110405 Copy
Species: Synthetic
Genetic Insert: Luciferase
Vector Backbone Description: Backbone Marker:#26655; Backbone Size:6783; Vector Backbone:pLKO.1-blast; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Comments: See Addgene's pLKO family protocol http://www.addgene.org/plko on how to use the pLKO family vectors.
Plasmid grows more slowly than standard plasmids.
Proper citation: RRID:Addgene_110409 Copy
Species: Synthetic
Genetic Insert: GFP
Vector Backbone Description: Backbone Marker:#21916; Backbone Size:10959; Vector Backbone:Tet-pLKO-neo; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31040181
Comments: See Addgene's pLKO family protocol http://www.addgene.org/plko on how to use the pLKO family vectors.
Plasmid grows more slowly than standard plasmids.
Proper citation: RRID:Addgene_110470 Copy
Species: Synthetic
Genetic Insert: monomeric Kusabira Orange 2
Vector Backbone Description: Backbone Marker:Plasmid #1764; Backbone Size:5177; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Comments: Weinberg Lab recommends using pUMVC (Addgene #8449) and VSV-G (#8454) for packaging.
Proper citation: RRID:Addgene_110353 Copy
Species: Homo sapiens
Genetic Insert: PKCZ
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_110512 Copy
Species: Homo sapiens
Genetic Insert: PLEKHS1
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pmCherry-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_110510 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the T1D Resources search. From here you can search through a compilation of resources used by T1D and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that T1D has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on T1D then you can log in from here to get additional features in T1D such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into T1D you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within T1D that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
