Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Xenopus laevis
Genetic Insert: Frzb-1 HA
Vector Backbone Description: Backbone Size:4100; Vector Backbone:pCS2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9118218
Comments: For sense, cut with NotI, transcribe with SP6.
HA tag is cloned between Ser158 and Met159 of Frezzled by PCR. HA tag includes a AatII diagnostic site.
Proper citation: RRID:Addgene_24979 Copy
Species: Xenopus laevis
Genetic Insert: Chordin
Vector Backbone Description: Backbone Size:3000; Vector Backbone:pBS-SK; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:8001117
Comments: Partial 2.8 kB clone of the original Xenopus chordin cDNA lacking 3' portion.
For antisense cut with EcoRI, transcribe with T7
For Northern blot probe, cut with EcoRI and XhoI
Proper citation: RRID:Addgene_24975 Copy
Species: Mus musculus
Genetic Insert: twisted gastrulation
Vector Backbone Description: Backbone Size:4100; Vector Backbone:pCS2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11714670
Comments: mRNA injection sense: cut with NotI, transcribe with SP6
Contains the Xenopus Chordin signal peptide and the N terminus until Ala41, followed by a Flag tag sequence.
Proper citation: RRID:Addgene_24974 Copy
Species: Drosophila melanogaster
Genetic Insert: HPat
Vector Backbone Description: Backbone Marker:Elisa Izaurralde; Backbone Size:6080; Vector Backbone:pAc5.1B-EGFP; Vector Types:Drosophila expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20404111
Proper citation: RRID:Addgene_25029 Copy
Genetic Insert: CMV-miR-31 sponge
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5000; Vector Backbone:pcDNA5-CMV-d2eGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19524507
Comments: miR-31 sponge generated by cloning oligonucleotides containing seven tandem “bulged” (at positions 9-12) miR-31 binding motifs (AGGCAAGACGAGGCATAGCT) into the XhoI and ApaI sites of the CMV sponge backbone.
Proper citation: RRID:Addgene_25025 Copy
Genetic Insert: synthetic miR-335 site
Vector Backbone Description: Backbone Marker:David Bartel, Addgene plasmid # 12179; Backbone Size:4085; Vector Backbone:pIS1; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19524507
Comments: Renilla luciferase reporter for miR-335 constructed by cloning oligo containing synthetic miR-335 binding site (GCCAGTGAGCTCTCAAGAGCAATAACGAAAAATGTACCGGTGCCAGT) into SacI and AgeI sites of the 3’ UTR of a pIS1 vector backbone.
Proper citation: RRID:Addgene_25028 Copy
Genetic Insert: synthetic miR-206 site
Vector Backbone Description: Backbone Marker:David Bartel, Addgene plasmid # 12179; Backbone Size:4085; Vector Backbone:pIS1; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19524507
Comments: Renilla luciferase reporter for miR-206 constructed by cloning oligo containing synthetic miR-206 binding site (GCCATTGAGCTCTGGAATGTAAGGAAGTGTGTGGACCGGTGCCATT) into SacI and AgeI sites of the 3’ UTR of a pIS1 vector backbone.
Proper citation: RRID:Addgene_25027 Copy
Species: Homo sapiens
Genetic Insert: LRRK2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:7464; Vector Backbone:pEF-DEST51; Vector Types:Mammalian Expression, Gateway Cloning; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18397888
Proper citation: RRID:Addgene_25080 Copy
Species: Homo sapiens
Genetic Insert: LRRK2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:7464; Vector Backbone:pEF-DEST51; Vector Types:Mammalian Expression, Gateway Cloning; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18397888
Proper citation: RRID:Addgene_25081 Copy
Species: Plasmodium vivax
Genetic Insert: Pv003920:C34523
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7737; Vector Backbone:pET15-MHL; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: PDB: 3B6N. http://www.thesgc.org/structures/3B6N/ .
Proper citation: RRID:Addgene_25118 Copy
Species: Cryptosporidium parvum
Genetic Insert: cgd5_3360:MAC029-C04:C34239
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7746; Vector Backbone:p15TV-L; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: PDB: 3BE4. http://www.thesgc.org/structures/3BE4/ .
Proper citation: RRID:Addgene_25119 Copy
Species: Plasmodium falciparum
Genetic Insert: PFE1350c:C34884
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7737; Vector Backbone:pET15-MHL; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: PDB: 2R0J. h http://www.thesgc.org/structures/2R0J/ .
Proper citation: RRID:Addgene_25114 Copy
Species: Plasmodium falciparum
Genetic Insert: PF11_0301:C22904
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7746; Vector Backbone:p15TV-L; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: PDB: 2PT9. http://www.thesgc.org/structures/2PT9/ .
Proper citation: RRID:Addgene_25110 Copy
Species: Cryptosporidium parvum
Genetic Insert: cgd5_2510:C29844
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7737; Vector Backbone:pET15-MHL; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: PDB: 2QKR. http://www.thesgc.org/structures/2QKR/ .
Proper citation: RRID:Addgene_25112 Copy
Species: Homo sapiens
Genetic Insert: LRRK2
Vector Backbone Description: Backbone Marker:Cookson Lab; Backbone Size:4300; Vector Backbone:pCMV-Tag 3B; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18397888
Comments: An additional Myc tag has been added to the original vector. The 2XMyc vector was adapted to the invitrogen gateway system by insertion of a gateway cloning cassette. LRRK2 was cloned by gateway recombination.
The domain structure and amino acid limits is approximate. According to depositor's domain organization, this construct contains the correct residues.
Proper citation: RRID:Addgene_25072 Copy
Species: Homo sapiens
Genetic Insert: human soluble FMS-like tyrosine kinase 3 ligand
Vector Backbone Description: Backbone Size:2961; Vector Backbone:pBS; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16517725
Proper citation: RRID:Addgene_25074 Copy
Species: E.coli
Genetic Insert: Edge detector
Vector Backbone Description: Backbone Marker:BioBrick vector-Shetty et al 2008; Backbone Size:3443; Vector Backbone:pSB4A3; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19563759
Proper citation: RRID:Addgene_25092 Copy
Species: Toxoplasma gondii
Genetic Insert: 541.m00134:MAC02T-C05:C40091
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7737; Vector Backbone:pET15-MHL; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: PDB: 3DXN. http://www.thesgc.org/structures/3DXN/ .
Proper citation: RRID:Addgene_25129 Copy
Species: Toxoplasma gondii
Genetic Insert: 59.m03510:C40207
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7737; Vector Backbone:pET15-MHL; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: PDB: 3CE7. http://www.thesgc.org/structures/3CE7/ .
Proper citation: RRID:Addgene_25124 Copy
Species: Homo sapiens
Genetic Insert: IRE1
Vector Backbone Description: Backbone Marker:Eric Campeau (Addgene plasmid 17293); Backbone Size:9594; Vector Backbone:pLenti CMV/TO Puro DEST (670-1); Vector Types:Mammalian Expression, Lentiviral, Gateway Cloning; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18286202
Comments: IRE1a cDNA was cut out of pENTR1A with EcoRI and XhoI and ligated into pLenti CMV/TO Puro DEST through Gateway cloning.
Proper citation: RRID:Addgene_20745 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the T1D Resources search. From here you can search through a compilation of resources used by T1D and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that T1D has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on T1D then you can log in from here to get additional features in T1D such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into T1D you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within T1D that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
