Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Saccharomyces cerevisiae
Genetic Insert: Hsh155 Hs 1-5 3x FLAG
Vector Backbone Description: Backbone Marker:ATCC; Backbone Size:5208; Vector Backbone:pRS414; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29752352
Proper citation: RRID:Addgene_111963 Copy
Species: Homo sapiens
Genetic Insert: CD4-GFP HDRT
Vector Backbone Description: Backbone Size:2686; Vector Backbone:pUC19; Vector Types:CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29995861
Comments: gRNA sequence that can be used with this DNA template: CTGGCCTCGTGCCTCAAATG
Proper citation: RRID:Addgene_112018 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Hsh155 Hs 1-16 3x FLAG
Vector Backbone Description: Backbone Marker:ATCC; Backbone Size:5208; Vector Backbone:pRS414; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29752352
Proper citation: RRID:Addgene_111966 Copy
Species: Synthetic
Genetic Insert: axon-GCaMP6f
Vector Backbone Description: Backbone Size:4579; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30127424
Proper citation: RRID:Addgene_112000 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Hsh155 V783A
Vector Backbone Description: Backbone Marker:ATCC; Backbone Size:4788; Vector Backbone:pRS414; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29752352
Proper citation: RRID:Addgene_111950 Copy
Species: Synthetic
Genetic Insert: axon-GCaMP6s-P2A-mRuby3
Vector Backbone Description: Backbone Size:4603; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30127424
Comments: Addgene NGS results found minor differences in the second ITR compared to the depositor-provided sequence. The depositing lab has confirmed that this does not impair AAV production
Proper citation: RRID:Addgene_112005 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Hsh155 1-945
Vector Backbone Description: Backbone Marker:ATCC; Backbone Size:5208; Vector Backbone:pRS414; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29752352
Proper citation: RRID:Addgene_112002 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Hsh155 K740R
Vector Backbone Description: Backbone Marker:ATCC; Backbone Size:4788; Vector Backbone:pRS414; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29752352
Proper citation: RRID:Addgene_111953 Copy
Species: Synthetic
Genetic Insert: axon-GCaMP6s-P2A-mRuby3
Vector Backbone Description: Backbone Size:5109; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30127424
Proper citation: RRID:Addgene_112008 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Hsh155 N747D
Vector Backbone Description: Backbone Marker:ATCC; Backbone Size:4788; Vector Backbone:pRS414; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29752352
Proper citation: RRID:Addgene_111954 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Hsh155 K818A
Vector Backbone Description: Backbone Marker:ATCC; Backbone Size:4788; Vector Backbone:pRS414; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29752352
Proper citation: RRID:Addgene_111951 Copy
Species: Synthetic
Genetic Insert: GCaMP6s-P2A-mKate2
Vector Backbone Description: Backbone Size:4603; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30127424
Comments: Addgene NGS results found minor differences in the second ITR compared to the depositor-provided sequence. The depositing lab has confirmed that this does not impair AAV production
Proper citation: RRID:Addgene_112006 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Hsh155 Y826A
Vector Backbone Description: Backbone Marker:ATCC; Backbone Size:4788; Vector Backbone:pRS414; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29752352
Proper citation: RRID:Addgene_111952 Copy
Species: Synthetic
Genetic Insert: GCaMP6s-P2A-mRuby3
Vector Backbone Description: Backbone Size:4603; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30127424
Comments: Addgene NGS results found minor differences in the second ITR compared to the depositor-provided sequence. The depositing lab has confirmed that this does not impair AAV production
Proper citation: RRID:Addgene_112007 Copy
Genetic Insert: RFP
Vector Backbone Description: Backbone Marker:ThermoFisherScientific; Backbone Size:2900; Vector Backbone:prSET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29671583
Proper citation: RRID:Addgene_111957 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Hsh155 V783L
Vector Backbone Description: Backbone Marker:ATCC; Backbone Size:4788; Vector Backbone:pRS414; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29752352
Proper citation: RRID:Addgene_111955 Copy
Genetic Insert: mEGFP
Vector Backbone Description: Backbone Size:4346; Vector Backbone:pETARA; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29671583
Proper citation: RRID:Addgene_111959 Copy
Species: Other
Genetic Insert: AtDeadCAS9 D10A H840A without stop codon
Vector Backbone Description: Vector Backbone:pAGM1287; Vector Types:Plant Expression, CRISPR; Bacterial Resistance:Spectinomycin
Comments: BsaI and BbsI sites have been removed from the sequence by site-directed mutagenesis.
Proper citation: RRID:Addgene_112073 Copy
Species: Other
Genetic Insert: 3xmVenus
Vector Backbone Description: Vector Backbone:pAGM1301; Vector Types:Plant Expression; Bacterial Resistance:Spectinomycin
Comments: BsaI and BbsI sites have been removed from the sequence by site-directed mutagenesis.
Proper citation: RRID:Addgene_112074 Copy
Species: Other
Genetic Insert: AtCAS9 D10A
Vector Backbone Description: Vector Backbone:pICH47742; Vector Types:Plant Expression, CRISPR; Bacterial Resistance:Ampicillin
Comments: BsaI and BbsI sites have been removed from the sequence by site-directed mutagenesis.
Proper citation: RRID:Addgene_112078 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the T1D Resources search. From here you can search through a compilation of resources used by T1D and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that T1D has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on T1D then you can log in from here to get additional features in T1D such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into T1D you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within T1D that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.