Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Oryza sativa
Genetic Insert: TIR1
Vector Backbone Description: Vector Backbone:pRS306; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29348368
Proper citation: RRID:Addgene_112035 Copy
Vector Backbone Description: Backbone Size:2787; Vector Backbone:pACYCDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:29724956
Proper citation: RRID:Addgene_111986 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Hsh155 96-972
Vector Backbone Description: Backbone Marker:ATCC; Backbone Size:5208; Vector Backbone:pRS414; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29752352
Proper citation: RRID:Addgene_111988 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Hsh155 103-972
Vector Backbone Description: Backbone Marker:ATCC; Backbone Size:5208; Vector Backbone:pRS414; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29752352
Proper citation: RRID:Addgene_111989 Copy
Species: Homo sapiens
Genetic Insert: SAP24
Vector Backbone Description: Backbone Marker:Amersham; Backbone Size:0; Vector Backbone:pGEX; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15998806
Comments: Reed lab clone #783.
Proper citation: RRID:Addgene_11202 Copy
Species: Homo sapiens
Genetic Insert: Prp16 N-terminus
Vector Backbone Description: Backbone Marker:Pharmacia; Backbone Size:4970; Vector Backbone:pGEX2TK; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9524131
Comments: Reed lab clone #354.
Proper citation: RRID:Addgene_11204 Copy
Species: Homo sapiens
Genetic Insert: NYESO alpha into TRAC HDRT
Vector Backbone Description: Backbone Size:2686; Vector Backbone:pUC19; Vector Types:CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29995861
Comments: gRNA sequence that can be used with this DNA template: AGAGTCTCTCAGCTGGTACA
Proper citation: RRID:Addgene_112023 Copy
Species: Homo sapiens
Genetic Insert: NYESO beta/alpha into TRAC HDRT
Vector Backbone Description: Backbone Size:2686; Vector Backbone:pUC19; Vector Types:CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29995861
Comments: gRNA sequence that can be used with this DNA template: AGAGTCTCTCAGCTGGTACA
Proper citation: RRID:Addgene_112021 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Hsh155 Hs 5-20 3x FLAG
Vector Backbone Description: Backbone Marker:ATCC; Backbone Size:5208; Vector Backbone:pRS414; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29752352
Proper citation: RRID:Addgene_111971 Copy
Species: Homo sapiens
Genetic Insert: LC3B
Vector Backbone Description: Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:29500346
Proper citation: RRID:Addgene_112026 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Hsh155 Hs 12-20 3x FLAG
Vector Backbone Description: Backbone Marker:ATCC; Backbone Size:5208; Vector Backbone:pRS414; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29752352
Proper citation: RRID:Addgene_111972 Copy
Species: Other
Genetic Insert: LacZ
Vector Backbone Description: Backbone Marker:Unknown; Backbone Size:4000; Vector Backbone:Synthetic; Vector Types:Unspecified; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30460568
Proper citation: RRID:Addgene_112027 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Hsh155 R778A 3x FLAG
Vector Backbone Description: Backbone Marker:ATCC; Backbone Size:5208; Vector Backbone:pRS414; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29752352
Proper citation: RRID:Addgene_111979 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Hsh155 R775A 3x FLAG
Vector Backbone Description: Backbone Marker:ATCC; Backbone Size:5208; Vector Backbone:pRS414; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29752352
Proper citation: RRID:Addgene_111977 Copy
Species: Other
Genetic Insert: TelN
Vector Backbone Description: Vector Backbone:pAA.3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29724956
Proper citation: RRID:Addgene_112011 Copy
Species: Homo sapiens
Genetic Insert: RAB11A-GFP HDRT
Vector Backbone Description: Backbone Size:2686; Vector Backbone:pUC19; Vector Types:CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29995861
Comments: gRNA sequence that can be used with this DNA template: GGTAGTCGTACTCGTCGTCG
Proper citation: RRID:Addgene_112012 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Hsh155 3x FLAG
Vector Backbone Description: Backbone Marker:ATCC; Backbone Size:5208; Vector Backbone:pRS414; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29752352
Proper citation: RRID:Addgene_111960 Copy
Species: Homo sapiens
Genetic Insert: CLTA-GFP HDRT
Vector Backbone Description: Backbone Size:2686; Vector Backbone:pUC19; Vector Types:CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29995861
Comments: gRNA sequence that can be used with this DNA template: GAACGGATCCAGCTCAGCCA
Proper citation: RRID:Addgene_112016 Copy
Species: Homo sapiens
Genetic Insert: RAB11A-mCherry HDRT
Vector Backbone Description: Backbone Size:2686; Vector Backbone:pUC19; Vector Types:CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29995861
Comments: gRNA sequence that can be used with this DNA template: GGTAGTCGTACTCGTCGTCG
Proper citation: RRID:Addgene_112013 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Hsh155 Hs 1-12 3x FLAG
Vector Backbone Description: Backbone Marker:ATCC; Backbone Size:5208; Vector Backbone:pRS414; Vector Types:Bacterial Expression, Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29752352
Proper citation: RRID:Addgene_111965 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the T1D Resources search. From here you can search through a compilation of resources used by T1D and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that T1D has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on T1D then you can log in from here to get additional features in T1D such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into T1D you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within T1D that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.