Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

742,877 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
pαH-S-GSAS-2P-Omicron-BA.5
 
Resource Report
Resource Website
RRID:Addgene_213828 pαH-S-GSAS/Omicron-2P-BA5 Ampicillin PMID:38405707 A portion of this plasmid was derived from a plasmid made by Jason McLellan; Terms and Licences: UBMTA, Not available to Industry; see this as a reference: https://www.addgene.org/164566/ Backbone Size:4746; Vector Backbone:pαH; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin G339D,R346T,S371F,S373P,S375F,T376A,D405N,R408S,K417N,N440K,L452R, S477N,T478K,E484A,F486V,Q498R,N501Y,Y505H,H655Y,N679K,P681H,N764K,D796Y,Q954H,N969K, K986P, V987P 2026-09-12 02:40:18 0
pEGFP-C1-deltaExon16-17
 
Resource Report
Resource Website
RRID:Addgene_209564 Shtn1 long isoform with E16-17 deletion Mus musculus Kanamycin PMID:30733148 Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin Exon16 and 17 deletion 2026-09-12 02:40:17 0
pLV-SFFV-ZFYVE27 S14D S25D S32D T261D-WPRE-UbC-mCherry
 
Resource Report
Resource Website
RRID:Addgene_214471 ZFYVE27 Homo sapiens Ampicillin Vector Backbone:pHRsinUbEm; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin S14D S25D S32D T261D 2026-09-12 02:40:18 0
pGS400_myc-8xGCN4-T2A-BSD Lenti
 
Resource Report
Resource Website
RRID:Addgene_211885 8xGCN4pep Synthetic Ampicillin Vector Backbone:pLenti; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin N/A 2026-09-12 02:40:18 0
pGS398_myc-4xGCN4-T2A-BSD Lenti
 
Resource Report
Resource Website
RRID:Addgene_211883 4xGCN4pep Synthetic Ampicillin Vector Backbone:pLenti; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin N/A 2026-09-12 02:40:18 0
pLKO.1-GST-EGFP-GPIBY55
 
Resource Report
Resource Website
RRID:Addgene_213717 EGFP Homo sapiens Ampicillin PMID:36250010 Vector Backbone:pLKO.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-12 02:40:18 0
pFlare9A-Clip2E9 Mutant
 
Resource Report
Resource Website
RRID:Addgene_209575 Clip2 Mus musculus Kanamycin PMID:30733148 Vector Backbone:pFlare9A; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin ACGCGTTTCTGAATTCTTCTAACTGCCCTCAAATGCACGGTGGCATGTGCACAGGCACACATACTAAATGAATAAATAAAATGCACCTAACAAACAAAGAAAGACTGACTCTTTAAATCCCACAAAGGAAGAAACTGGGGTACCCATAGCCACTGCGTTATCAGAGGCTGGCAAGGGGTGGTTCCCAGAGCCTCTTCTGCCTTGAACACACGCCCAGCTAGCCCCAGTGATGGGAGGGCACCCAGGAGAAAGCAATTCCGGCTCATTGAAGTCTTGTTCACGGAAGATGACGCACGGAATATTCCTTTCCCCACGTCCCTGCCTTCCCTGTCCACCCTGCCATCCCTCCCCCACCCCCGCCCTGGGTGGAGCAGACCCAGACCCAGCTGGAGCACGCGCGCATTGGGGAGCTGGAGCAGAGCCTGCTATTGGAGAAGGCGCAGGCCGAGCGGCTGCTCAGAGAATTAGCGGATAACAGGGTAAACCGCGCCTGCCACTGTCACCCACCCGGCCAGCGCCTTGGCCCCTAGATGCCCCCTTTGCTTTTTAAATCATTTCCTCTGCCATCACAATGGCTCCTCTTACTATTGCTTTTTGGAGACCCTTCTGAACTCCCCTCTGGGAGGGAAGCTGAGATTTAGAGTCAAGCTCACTGTGGCCAAGTAGTGCTCTTAGGGAAGGGGGGTTTGGTCCTCTGGGATTTCTTCCAAGTTCATTGCTCCTTGAGCAGAGGTGTCTCTGTGAGACCTTCCCTGTGCCTCCCTCCTGTCCCTTGCCAGAAAGAAGCCTTCTTGGAGTGGCCTGCCCCTTACTTGGATAGACATGGGCTTCCTTGGCAGGAATGCAGACCCAGAGTGTTCTAGCCTAGAGAATCTTAAGATGGCAGCAGAGAGCCAACCTGGAGGACGGATCCATAGTCGACC 2026-09-12 02:40:18 0
pEM7067
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_214005 eGFP-AAV Synthetic Ampicillin PMID:38589953 Vector Backbone:pKH70-PrpsM; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-09-12 02:40:18 1
pEM7069
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_214007 mScarlet-I-AAV Synthetic Ampicillin PMID:38589953 Vector Backbone:pKH70-PrpsM; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-09-12 02:40:18 1
pEM7070
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_214008 mNeonGreen-ASV Synthetic Ampicillin PMID:38589953 Vector Backbone:pKH70-PrpsM; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-09-12 02:40:18 1
pEM7071
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_214009 mScarlet-I-ASV Synthetic Ampicillin PMID:38589953 Vector Backbone:pKH70-PrpsM; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-09-12 02:40:18 1
pEM7063
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_214001 eGFP-LVA Synthetic Ampicillin PMID:38589953 Vector Backbone:pKH70-PrpsM; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-09-12 02:40:18 1
pEM7064
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_214002 mNeonGreen-LVA Synthetic Ampicillin PMID:38589953 Vector Backbone:pKH70-PrpsM; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-09-12 02:40:18 1
pEM7065
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_214003 mCerulean-LVA Synthetic Ampicillin PMID:38589953 Vector Backbone:pKH70-PrpsM; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-09-12 02:40:18 1
pAAV2_hSyn_NES-Caprola_05-mEGFP_WRPE-SV40
 
Resource Report
Resource Website
RRID:Addgene_194689 Caprola_05-mEGFP Synthetic Ampicillin PMID:38386755 Backbone Size:4200; Vector Backbone:pAAV2; Vector Types:AAV; Bacterial Resistance:Ampicillin 2026-09-12 02:40:19 0
pLKO.1-scrCdh10.1 GFP
 
Resource Report
Resource Website
RRID:Addgene_209102 scrCdh10.1 Ampicillin PMID:37707499 Vector Backbone:pLKO.1; Vector Types:; Bacterial Resistance:Ampicillin 2026-09-12 02:40:19 0
pLKO.1-scrCdh11.1 GFP
 
Resource Report
Resource Website
RRID:Addgene_209104 scrCdh11.1 Ampicillin PMID:37707499 Vector Backbone:pLKO.1; Vector Types:; Bacterial Resistance:Ampicillin 2026-09-12 02:40:19 0
pDonor-Prf1-ires-mCherry
 
Resource Report
Resource Website
RRID:Addgene_209073 Prf1-ires-mCherry HDR template (parts of Prf1 with mutated PAM) Mus musculus Ampicillin PMID:38306418 Backbone Size:3155; Vector Backbone:pDonor; Vector Types:CRISPR; Bacterial Resistance:Ampicillin 2026-09-12 02:40:19 0
pDonor-Prf1-mock-ires-mCherry
 
Resource Report
Resource Website
RRID:Addgene_209074 Prf1-mock-ires-mCherry HDR template (parts of Prf1(S399Stop) with mutated PAM) Mus musculus Ampicillin PMID:38306418 Backbone Size:3155; Vector Backbone:pDonor; Vector Types:CRISPR; Bacterial Resistance:Ampicillin 2026-09-12 02:40:19 0
pDonor-PRF1-Exon3
 
Resource Report
Resource Website
RRID:Addgene_209075 PRF1-Exon3 HDRT Homo sapiens Ampicillin PMID:38306418 Backbone Size:3155; Vector Backbone:pDonor; Vector Types:CRISPR; Bacterial Resistance:Ampicillin 2026-09-12 02:40:19 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. Type 1 Diabetes Research Networks Resources

    Welcome to the T1D Resources search. From here you can search through a compilation of resources used by T1D and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that T1D has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on T1D then you can log in from here to get additional features in T1D such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into T1D you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.